ID: 959419605

View in Genome Browser
Species Human (GRCh38)
Location 3:106112680-106112702
Sequence CCCGGCGGCGCTCGCCGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419588_959419605 22 Left 959419588 3:106112635-106112657 CCCTCGGGCCCCGCGGGGCCCGT 0: 61
1: 11
2: 0
3: 3
4: 108
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419595_959419605 -1 Left 959419595 3:106112658-106112680 CCGCTCCTCCAGCCGCTGCCTCC 0: 69
1: 2
2: 12
3: 180
4: 1558
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419589_959419605 21 Left 959419589 3:106112636-106112658 CCTCGGGCCCCGCGGGGCCCGTC 0: 61
1: 11
2: 0
3: 27
4: 278
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419590_959419605 14 Left 959419590 3:106112643-106112665 CCCCGCGGGGCCCGTCCGCTCCT 0: 62
1: 8
2: 1
3: 13
4: 130
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419591_959419605 13 Left 959419591 3:106112644-106112666 CCCGCGGGGCCCGTCCGCTCCTC 0: 67
1: 6
2: 1
3: 18
4: 221
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419599_959419605 -9 Left 959419599 3:106112666-106112688 CCAGCCGCTGCCTCCCCGGCGGC No data
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419593_959419605 4 Left 959419593 3:106112653-106112675 CCCGTCCGCTCCTCCAGCCGCTG 0: 68
1: 1
2: 3
3: 34
4: 289
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419594_959419605 3 Left 959419594 3:106112654-106112676 CCGTCCGCTCCTCCAGCCGCTGC 0: 70
1: 0
2: 5
3: 61
4: 657
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419597_959419605 -6 Left 959419597 3:106112663-106112685 CCTCCAGCCGCTGCCTCCCCGGC No data
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419592_959419605 12 Left 959419592 3:106112645-106112667 CCGCGGGGCCCGTCCGCTCCTCC 0: 65
1: 6
2: 3
3: 38
4: 332
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419586_959419605 27 Left 959419586 3:106112630-106112652 CCTTGCCCTCGGGCCCCGCGGGG 0: 66
1: 10
2: 2
3: 30
4: 250
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419605 Original CRISPR CCCGGCGGCGCTCGCCGGCG CGG Intergenic
No off target data available for this crispr