ID: 959419607

View in Genome Browser
Species Human (GRCh38)
Location 3:106112683-106112705
Sequence GGCGGCGCTCGCCGGCGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419597_959419607 -3 Left 959419597 3:106112663-106112685 CCTCCAGCCGCTGCCTCCCCGGC No data
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG No data
959419594_959419607 6 Left 959419594 3:106112654-106112676 CCGTCCGCTCCTCCAGCCGCTGC No data
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG No data
959419600_959419607 -10 Left 959419600 3:106112670-106112692 CCGCTGCCTCCCCGGCGGCGCTC No data
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG No data
959419592_959419607 15 Left 959419592 3:106112645-106112667 CCGCGGGGCCCGTCCGCTCCTCC No data
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG No data
959419591_959419607 16 Left 959419591 3:106112644-106112666 CCCGCGGGGCCCGTCCGCTCCTC No data
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG No data
959419590_959419607 17 Left 959419590 3:106112643-106112665 CCCCGCGGGGCCCGTCCGCTCCT No data
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG No data
959419588_959419607 25 Left 959419588 3:106112635-106112657 CCCTCGGGCCCCGCGGGGCCCGT No data
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG No data
959419593_959419607 7 Left 959419593 3:106112653-106112675 CCCGTCCGCTCCTCCAGCCGCTG No data
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG No data
959419599_959419607 -6 Left 959419599 3:106112666-106112688 CCAGCCGCTGCCTCCCCGGCGGC No data
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG No data
959419595_959419607 2 Left 959419595 3:106112658-106112680 CCGCTCCTCCAGCCGCTGCCTCC No data
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG No data
959419589_959419607 24 Left 959419589 3:106112636-106112658 CCTCGGGCCCCGCGGGGCCCGTC No data
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG No data
959419586_959419607 30 Left 959419586 3:106112630-106112652 CCTTGCCCTCGGGCCCCGCGGGG No data
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419607 Original CRISPR GGCGGCGCTCGCCGGCGCGG CGG Intergenic