ID: 959419607

View in Genome Browser
Species Human (GRCh38)
Location 3:106112683-106112705
Sequence GGCGGCGCTCGCCGGCGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 46, 1: 12, 2: 3, 3: 33, 4: 309}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419595_959419607 2 Left 959419595 3:106112658-106112680 CCGCTCCTCCAGCCGCTGCCTCC 0: 69
1: 2
2: 12
3: 180
4: 1558
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419599_959419607 -6 Left 959419599 3:106112666-106112688 CCAGCCGCTGCCTCCCCGGCGGC No data
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419593_959419607 7 Left 959419593 3:106112653-106112675 CCCGTCCGCTCCTCCAGCCGCTG 0: 68
1: 1
2: 3
3: 34
4: 289
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419586_959419607 30 Left 959419586 3:106112630-106112652 CCTTGCCCTCGGGCCCCGCGGGG 0: 66
1: 10
2: 2
3: 30
4: 250
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419600_959419607 -10 Left 959419600 3:106112670-106112692 CCGCTGCCTCCCCGGCGGCGCTC No data
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419589_959419607 24 Left 959419589 3:106112636-106112658 CCTCGGGCCCCGCGGGGCCCGTC 0: 61
1: 11
2: 0
3: 27
4: 278
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419592_959419607 15 Left 959419592 3:106112645-106112667 CCGCGGGGCCCGTCCGCTCCTCC 0: 65
1: 6
2: 3
3: 38
4: 332
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419588_959419607 25 Left 959419588 3:106112635-106112657 CCCTCGGGCCCCGCGGGGCCCGT 0: 61
1: 11
2: 0
3: 3
4: 108
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419594_959419607 6 Left 959419594 3:106112654-106112676 CCGTCCGCTCCTCCAGCCGCTGC 0: 70
1: 0
2: 5
3: 61
4: 657
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419591_959419607 16 Left 959419591 3:106112644-106112666 CCCGCGGGGCCCGTCCGCTCCTC 0: 67
1: 6
2: 1
3: 18
4: 221
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419597_959419607 -3 Left 959419597 3:106112663-106112685 CCTCCAGCCGCTGCCTCCCCGGC No data
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419590_959419607 17 Left 959419590 3:106112643-106112665 CCCCGCGGGGCCCGTCCGCTCCT 0: 62
1: 8
2: 1
3: 13
4: 130
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419607 Original CRISPR GGCGGCGCTCGCCGGCGCGG CGG Intergenic
900123603 1:1059743-1059765 CGCGCCGCTCGCCGGCGCTCGGG - Intergenic
900162829 1:1232424-1232446 GGCGGCGCGCGCGGGCGCGGGGG - Exonic
901577250 1:10210811-10210833 CGCGGCGCGCGGGGGCGCGGGGG - Exonic
902323703 1:15684678-15684700 GGCGGCGCTCTCCCGGGCCGGGG + Intronic
902501446 1:16914148-16914170 GGGGGCGCGCGCGTGCGCGGGGG + Intronic
902515209 1:16986319-16986341 GGCGGCGCAGGCAGGCGGGGAGG + Exonic
903526511 1:23995016-23995038 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
903597051 1:24502915-24502937 GGCCGCTCTCGCCGGCGTCGAGG + Exonic
903845922 1:26279994-26280016 GGCGGCGCGGGCAGGCGGGGTGG - Exonic
903923408 1:26817396-26817418 GGCGGCGCTCGCTGGCGCGGCGG - Intergenic
904106429 1:28088752-28088774 GGCGTGGCTCGCCGGGCCGGCGG - Intergenic
904618081 1:31760686-31760708 GGCGGCGAGCGCCGGGGAGGCGG - Intronic
904794809 1:33051266-33051288 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
906062759 1:42958987-42959009 GGCGGCGCTCTGCGGGGAGGGGG + Intergenic
906365391 1:45205895-45205917 GGCGGAGCCGGCCGGAGCGGCGG + Exonic
906436913 1:45803992-45804014 GGCGGCGCTCGCCGGCGCGGCGG - Exonic
906486639 1:46240427-46240449 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
906615764 1:47231974-47231996 GGCGGCGGCAGCCGGGGCGGGGG + Intronic
907278130 1:53328081-53328103 GGTGACGCTCGGCGGCGGGGCGG + Intergenic
907430273 1:54407036-54407058 GGCGGCTCGAGCCGGCGCCGAGG + Intronic
907453932 1:54563116-54563138 GGCGGCGCTCGCTGGCGCGGCGG + Intronic
908355781 1:63323841-63323863 GGCGGCGGCGGCCGGCGCCGCGG + Exonic
910981245 1:92961550-92961572 CGCGGCGCGCGCCGCGGCGGGGG - Intergenic
912532750 1:110338492-110338514 GGCGGCGCTCTCCCGCGCGCGGG + Exonic
912825495 1:112899366-112899388 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
913959328 1:143327041-143327063 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
913959338 1:143327085-143327107 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
913959355 1:143327155-143327177 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
913959367 1:143327199-143327221 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
913959379 1:143327243-143327265 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
914053647 1:144152421-144152443 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
914053657 1:144152465-144152487 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
914053673 1:144152535-144152557 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
914053685 1:144152579-144152601 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
914125434 1:144813680-144813702 GGCGGCCAGCGGCGGCGCGGCGG - Intergenic
914125446 1:144813724-144813746 GGCGGCCAGCGGCGGCGCGGCGG - Intergenic
914125458 1:144813768-144813790 GGCGGCCAGCGGCGGCGCGGCGG - Intergenic
914125512 1:144813962-144813984 GGCGGCCAGCGGCGGCGCGGCGG - Intergenic
914125524 1:144814006-144814028 GGCGGCCAGCGGCGGCGCGGCGG - Intergenic
914125540 1:144814076-144814098 GGCGGCCAGCGGCGGCGCGGCGG - Intergenic
914125550 1:144814120-144814142 GGCGGCCAGCGGCGGCGCGGCGG - Intergenic
916666988 1:166975554-166975576 GGCCGAGCTCCCCCGCGCGGCGG - Intergenic
919699920 1:200620966-200620988 GGCGGCGGTCGCGGGCGCAGCGG + Intergenic
921414457 1:214870472-214870494 GGCGGTGCTCGCCGGCGCGGCGG + Intergenic
921934729 1:220786383-220786405 GCCTTGGCTCGCCGGCGCGGAGG + Intergenic
922098858 1:222465570-222465592 GGCGGCGCTCTCGGCCCCGGCGG - Intergenic
922739369 1:228006878-228006900 GGGGGCGCCCGCCGGGGCCGGGG - Intergenic
924540004 1:244971159-244971181 CGCGGCGCTAGCCGGCGGCGGGG - Intronic
1064244321 10:13657155-13657177 GGCGGCGCGCGGGGGTGCGGGGG - Exonic
1064418209 10:15168616-15168638 GGCGGCGCTGGCTGGGGAGGCGG + Exonic
1064443018 10:15370765-15370787 GGCGGCGCGGGCCGGCGACGCGG - Intronic
1065023082 10:21516865-21516887 GGCGGCGGCGGCCGCCGCGGGGG - Exonic
1065025093 10:21534094-21534116 CGCGCCGCTCGCCGCCGCCGAGG - Intergenic
1065214938 10:23439711-23439733 GGCGGCGGAGGCGGGCGCGGCGG - Exonic
1066080801 10:31928839-31928861 GTCGGAGCGCGCCGGCGCGGGGG + Intronic
1066464403 10:35640340-35640362 GGCGGCGGGCGCGGGCGCGGCGG - Exonic
1066464557 10:35640921-35640943 GGCGGCGGCAGGCGGCGCGGCGG + Exonic
1068910482 10:62374259-62374281 GGCGGCGCTCGCGGGCACCGTGG - Exonic
1070179153 10:73997958-73997980 GGCGGGGTTTGGCGGCGCGGTGG + Intergenic
1070327599 10:75398824-75398846 GGCGGCGGGCACCGGCACGGGGG + Exonic
1071690872 10:87818289-87818311 ACCCGCGGTCGCCGGCGCGGAGG + Intronic
1072102183 10:92239730-92239752 GGCGGCGCTCCTCTGCGCGTAGG + Exonic
1072454112 10:95561275-95561297 GGCCGCGCTTGCCCGCTCGGCGG - Intronic
1072950137 10:99840175-99840197 GGCGGCGCTCGCCGGCGCGGCGG + Intronic
1074055972 10:109923253-109923275 GGCCGCGCTCGCCGGAGCCCCGG - Intronic
1075040706 10:119104586-119104608 GGCGGCGCGGCGCGGCGCGGCGG + Intronic
1076372515 10:129964470-129964492 GGTGGCGCTCGGCGGCGGCGGGG - Intergenic
1076864426 10:133160072-133160094 GGCGGCGGGAGCCGGCGAGGGGG + Intergenic
1077008141 11:368897-368919 GGCCGCGCTCGGTGGGGCGGGGG + Intergenic
1077360868 11:2139585-2139607 GGCGGCGGTCGCAGGGGCTGGGG + Intronic
1081784966 11:45739224-45739246 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
1081870462 11:46380717-46380739 GGCCGCGCTCGTCGGGGCCGGGG + Intergenic
1083617989 11:64035870-64035892 GGGTGCGCTCGGCGGCGGGGCGG - Intronic
1083772977 11:64878662-64878684 GGCGGCGCTAGCCGCCACTGAGG - Exonic
1083772979 11:64878669-64878691 GGCGGCTAGCGCCGCCGCGGCGG + Exonic
1084010933 11:66347850-66347872 GGGTGCGCGCGCCGGCGGGGAGG - Intergenic
1084516069 11:69638546-69638568 GGCCGCGGTCACCGGGGCGGGGG + Intergenic
1090345072 11:126062894-126062916 GCCCGCGCTCCCCGGCGGGGAGG - Intronic
1091000998 11:131910787-131910809 GGCGGGGCTCGGCGGGGCAGGGG - Intronic
1091233412 11:134002940-134002962 GGCGGCGCTCGTCGGGGAGGGGG + Intergenic
1091273107 11:134331860-134331882 GGCGGGGCTGGCCGGGGCCGGGG - Exonic
1091571512 12:1691032-1691054 GGCGGCGGTCGCTGTCGCGGCGG + Exonic
1092263902 12:6967034-6967056 GGCTTCTCTGGCCGGCGCGGTGG - Intronic
1092659476 12:10722962-10722984 GGCGGCGGGCGCCGGGGCCGCGG + Exonic
1092881606 12:12891510-12891532 GGCGGCCCTCGCCGGAGGGAGGG - Exonic
1093741390 12:22693315-22693337 GGCGGCGCTGGCCGGCGGCTCGG + Intergenic
1094218589 12:27970589-27970611 GCCGGCTCCTGCCGGCGCGGCGG + Intronic
1094536062 12:31324077-31324099 GGGGCCGCTCGCCGGGGCGAGGG + Intronic
1095439332 12:42227125-42227147 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
1096022496 12:48333813-48333835 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
1097007865 12:55931950-55931972 GGCGCCGGGCGCGGGCGCGGCGG + Intronic
1097223263 12:57462408-57462430 GGCCGGGCCGGCCGGCGCGGTGG - Intronic
1097648139 12:62260608-62260630 GGCGGCGGCCGCCGGGGCAGCGG + Intronic
1101302370 12:103495524-103495546 GGCCGCGCTCGCCTCCGCGGGGG + Intronic
1101494000 12:105236294-105236316 GCCTGCGCTCGCCGGCTCGCGGG + Intronic
1102370984 12:112382220-112382242 GGCGCCGCTGGCGGGCGCGGCGG - Intronic
1102520706 12:113476299-113476321 GGCGGTGCTCTGCGGCGCTGCGG - Intergenic
1102578377 12:113871811-113871833 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
1103348410 12:120265893-120265915 GGCGTCGCTGGGCGGGGCGGTGG + Intergenic
1103404723 12:120667097-120667119 GGGGGCGCCCGCCGACGAGGAGG + Exonic
1103856113 12:123972520-123972542 GGCGGCGCCCGCAGGTGAGGCGG - Exonic
1104961572 12:132490593-132490615 GCCGGCGCTCGCGCGCGCAGCGG + Exonic
1107481533 13:40789653-40789675 GGCTGCGCTCACCGCCGCGCCGG - Exonic
1110269165 13:73574230-73574252 GGCGGCGCTTGCCGGCGCGGCGG - Intergenic
1112344279 13:98577121-98577143 CTCGGCGCTCGCGGGCTCGGCGG - Intronic
1113082722 13:106535172-106535194 CGCGGGGCGCGGCGGCGCGGCGG + Intergenic
1115651170 14:35403985-35404007 GCCGGCGCCCGCCGGGGCCGCGG - Intronic
1116186322 14:41605383-41605405 GGCGCCGCTCGCCGACCTGGAGG + Intergenic
1116871626 14:50073911-50073933 GGCGGCGCTCGCCGGCGGGGCGG - Intergenic
1117875925 14:60249713-60249735 GGCGGTGCGGGCCTGCGCGGCGG + Intronic
1117920802 14:60723834-60723856 GGCGGCGGCGGCCGGAGCGGCGG - Exonic
1118320417 14:64749281-64749303 GGTGGGGCTGGCGGGCGCGGCGG - Exonic
1118849202 14:69571846-69571868 GGAGGCGCTGGCCCGGGCGGGGG - Exonic
1119003926 14:70907621-70907643 GGCGGCGAGCGGCGGGGCGGAGG - Exonic
1121050490 14:90816451-90816473 GGCGGCGGCGGCGGGCGCGGCGG + Intronic
1121617732 14:95324108-95324130 GGCGGCCTTCGCCGGAGTGGTGG + Intergenic
1122300145 14:100726871-100726893 GGCGGCGCGCGCGGCGGCGGCGG + Exonic
1122719853 14:103715988-103716010 GGAGGCGCTGGCCGGGGCGACGG - Intronic
1122775968 14:104117102-104117124 AGCGGCGGTGGCCAGCGCGGCGG - Intergenic
1122905697 14:104800597-104800619 GGCAGCGCGCCCCGGCGGGGAGG - Intronic
1122964035 14:105112745-105112767 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
1122993334 14:105249105-105249127 GTGGGCGCGCGCGGGCGCGGGGG - Intronic
1123004627 14:105315198-105315220 GGCCGCGCTTGCCGGAGCTGCGG - Exonic
1123025034 14:105420264-105420286 GGCGGGGCTCGGCGGCCCGGGGG + Intronic
1123048369 14:105529128-105529150 GGCGGCGCGGCGCGGCGCGGCGG + Exonic
1124629495 15:31328392-31328414 GGCGGCGCTTGGCGATGCGGGGG + Intronic
1125658992 15:41381884-41381906 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1127224892 15:56918610-56918632 CGCGGCTCTTCCCGGCGCGGAGG + Exonic
1127488195 15:59438272-59438294 CGCGGCACTCACCGGCGCGGGGG - Exonic
1127931643 15:63600986-63601008 GCGGGCGCGCGCGGGCGCGGGGG - Intronic
1128223070 15:65982267-65982289 AGAGGCACTCGCCGGCGCGGGGG + Exonic
1129428262 15:75480757-75480779 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
1131200042 15:90388402-90388424 TGCGGGGCTCCGCGGCGCGGGGG + Intronic
1131493506 15:92882883-92882905 GGCGGGCCTCGCGGCCGCGGCGG - Intergenic
1131635734 15:94231484-94231506 GGCGGGGCTCGCAAGGGCGGTGG + Intergenic
1132663799 16:1072812-1072834 GGCGGCACTCACCTGGGCGGCGG - Intergenic
1132750989 16:1457631-1457653 GGCGGCCCTCGCGGGCCCGGCGG + Intronic
1133059169 16:3163400-3163422 GGCCGGGCGCGCAGGCGCGGGGG - Intergenic
1134149827 16:11797048-11797070 GGCGGCGCGCGCGGGGGGGGCGG + Intronic
1136540224 16:30924384-30924406 GGCGGCCATCGGCGGCGGGGGGG - Intronic
1136641527 16:31569351-31569373 GGCGGCGGGCGCCGGGGCCGCGG + Intergenic
1139761450 16:69187443-69187465 GGCGGCGCCGGCGGGCTCGGGGG - Exonic
1140458131 16:75116282-75116304 GGCGGGGCGCGGCGGGGCGGGGG + Intronic
1141830123 16:86505736-86505758 GGCGGCGGCGGCCGGCGGGGCGG + Intergenic
1142752794 17:1998504-1998526 GGCAGCGGTGGCCGGCCCGGGGG - Intronic
1142974591 17:3636063-3636085 GGCGGCGGTCGAGAGCGCGGTGG - Exonic
1143099868 17:4499071-4499093 GGCGGCGGCGGGCGGCGCGGAGG + Exonic
1143174915 17:4950053-4950075 GGCCGCGCGGGCCGGCGGGGCGG + Intronic
1143181634 17:4987431-4987453 AGCGGCGCCCCCTGGCGCGGGGG + Intronic
1145012587 17:19378321-19378343 GGCGGCTCCCGCCGGCGAGCTGG + Intronic
1145041353 17:19580091-19580113 GGCGGCGCTCGCGGGCCCAGTGG + Intergenic
1145205654 17:20983966-20983988 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1146057785 17:29589692-29589714 GGCAGCGCGCGGCGGGGCGGGGG - Intronic
1146271433 17:31488172-31488194 GGCGGCGCGCGGGGACGCGGCGG - Intronic
1147636349 17:41966814-41966836 GGGGCCGCCCGCCTGCGCGGAGG - Exonic
1147659142 17:42107909-42107931 GGCGGGGCCTGCCGGGGCGGAGG - Intronic
1147661925 17:42121310-42121332 GGCGCCGCTCTCCGCTGCGGGGG - Exonic
1147963171 17:44179968-44179990 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1148440407 17:47709003-47709025 GGCGGCGGTGGCCGGGGCTGCGG - Exonic
1149614743 17:57988277-57988299 GCCCGCGCTCGCCGCCGCGGTGG - Intergenic
1149614750 17:57988284-57988306 GGCGGCGAGCGCGGGCGGGGGGG + Intergenic
1149908714 17:60550800-60550822 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1150137595 17:62704162-62704184 GGAGGCCCTCGCCGAGGCGGAGG + Intronic
1150168465 17:62966565-62966587 GGCTGCGCTCGCCGGCTGCGAGG + Intergenic
1150310958 17:64129582-64129604 GCCGGCGCCCGCCCGCGAGGAGG + Intronic
1150692616 17:67378385-67378407 GGCGGCGCTGGGTGGGGCGGCGG + Intronic
1150802366 17:68291904-68291926 CGCGGCGCTCGCGGCTGCGGCGG + Intronic
1151296906 17:73192827-73192849 GGGGGCGGGCGCGGGCGCGGGGG - Intronic
1152711205 17:81871215-81871237 GGCGGCGCCGGCGGGGGCGGGGG - Intronic
1152721753 17:81927088-81927110 GTCAGCTCTCCCCGGCGCGGGGG - Intronic
1152923711 17:83078555-83078577 GGCGGAGCTGGCCCGCCCGGCGG - Intergenic
1153457264 18:5295376-5295398 GGCGGCTGTAGGCGGCGCGGCGG + Intronic
1154241479 18:12657641-12657663 GGCGGCGGGCGGCGGCGCGCAGG + Exonic
1154241565 18:12657977-12657999 GGCGGCGCGCGCGGCCGCGTTGG - Exonic
1156502210 18:37566965-37566987 AGCCGCGCTCTCCGGGGCGGGGG - Intergenic
1157794287 18:50560166-50560188 GGCCGAGCGCGCCGGCGCCGCGG + Exonic
1158259067 18:55588000-55588022 TGCGGGGCTCGGCGGGGCGGAGG - Intronic
1160452451 18:78974529-78974551 GGGTGGGCTCGCCGGCGTGGAGG - Intergenic
1160706272 19:531684-531706 GGCGGTGCGCGCAGGCGCAGCGG + Intergenic
1160864570 19:1251094-1251116 GGCGGCGGCCGCCTGCGCCGGGG + Intronic
1160966650 19:1749677-1749699 GGAGCCGCTCGCCGCGGCGGGGG + Intergenic
1161265131 19:3360265-3360287 GGCCGCGCTCGGCGCCGCGCAGG + Intronic
1161382142 19:3971051-3971073 GGCGGCGGTGGCCAGCGCGGCGG - Exonic
1161959551 19:7516202-7516224 GGCGGCCGGCGCGGGCGCGGCGG + Exonic
1162341894 19:10096296-10096318 GGCGGCGGCCGACGGCGCCGTGG - Exonic
1162396445 19:10420430-10420452 GGCGGCGCTGACAGCCGCGGCGG + Intronic
1162886678 19:13702726-13702748 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1164051156 19:21586633-21586655 GGCCGCCCGCCCCGGCGCGGAGG - Intergenic
1164191894 19:22925473-22925495 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1164492520 19:28727737-28727759 GGGGGCGCTTGGCGGGGCGGCGG - Intergenic
1164653354 19:29901751-29901773 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
1165157822 19:33798438-33798460 GGCGGGGCTCGGCGGCGGGCGGG + Exonic
1165803129 19:38565171-38565193 GGCGGGGCTCGAGGGCACGGCGG + Exonic
1165851404 19:38852080-38852102 GGCCGTGCGCGCCGGCGCGAGGG - Intronic
1166261424 19:41644196-41644218 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
1166781703 19:45346596-45346618 GGCTGCGCTCGCAGGCCCGGCGG + Exonic
1167501447 19:49851017-49851039 TGCGGGCCTCTCCGGCGCGGGGG - Intronic
1168258583 19:55180221-55180243 CGCGGAGCTCTCCGGGGCGGGGG + Exonic
1168688436 19:58362527-58362549 GGCCGCTCTGGACGGCGCGGAGG + Intronic
1168718984 19:58544633-58544655 GGCGGCGCTCGGCCTCGCGGCGG + Exonic
1202693040 1_KI270712v1_random:104844-104866 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
1202693050 1_KI270712v1_random:104888-104910 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
1202693061 1_KI270712v1_random:104932-104954 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
1202693072 1_KI270712v1_random:104976-104998 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
1202693085 1_KI270712v1_random:105020-105042 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
1202693104 1_KI270712v1_random:105089-105111 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693116 1_KI270712v1_random:105133-105155 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693128 1_KI270712v1_random:105177-105199 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693140 1_KI270712v1_random:105221-105243 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693152 1_KI270712v1_random:105265-105287 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693164 1_KI270712v1_random:105309-105331 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693176 1_KI270712v1_random:105353-105375 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693188 1_KI270712v1_random:105397-105419 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693200 1_KI270712v1_random:105441-105463 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693211 1_KI270712v1_random:105485-105507 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693223 1_KI270712v1_random:105529-105551 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693248 1_KI270712v1_random:105635-105657 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
1202693259 1_KI270712v1_random:105679-105701 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
1202693270 1_KI270712v1_random:105723-105745 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
1202693281 1_KI270712v1_random:105767-105789 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
925609636 2:5692514-5692536 GACGACGGCCGCCGGCGCGGTGG - Intergenic
925856643 2:8135249-8135271 GGCGGCCCTCACTGGCGCGCCGG + Intergenic
929983192 2:46699495-46699517 GGCCGCGGACGACGGCGCGGGGG - Intronic
930177419 2:48314871-48314893 GGCGCAGCTCCCGGGCGCGGAGG + Intronic
930798659 2:55419892-55419914 GGCGGCGCTGGCGGGCGGCGAGG - Intronic
931291963 2:60881441-60881463 GGGGGCGGTCGCGCGCGCGGCGG + Intergenic
932763718 2:74457461-74457483 GGCGGCTCCAGGCGGCGCGGCGG + Exonic
933953355 2:87349118-87349140 GGCGGCCAGCGGCGGCGCGGCGG - Intergenic
934237559 2:90245349-90245371 GGCGGCCAGCGGCGGCGCGGTGG - Intergenic
934275638 2:91571363-91571385 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
934275649 2:91571407-91571429 GGCGGCCAGCGGCGGCGCGGCGG + Intergenic
934459993 2:94208687-94208709 GGCGGCCAGCGGCGGCGCGGCGG - Intergenic
934460011 2:94208757-94208779 GGCGGCCAGCGGCGGCGCGGCGG - Intergenic
934460018 2:94208783-94208805 GGCGGCCAGCGGCGGCGCGGCGG - Intergenic
934500550 2:94857489-94857511 GGCGGCGCGCGCCGGCAGGTAGG + Intergenic
934763505 2:96868723-96868745 GGCGGCGCGCGCAGGCGACGGGG + Intronic
936038322 2:109129642-109129664 GGCGGCGGCCACCGCCGCGGGGG + Exonic
936545973 2:113393767-113393789 GGCGGCGCTCGCCGGCGCGGTGG - Intergenic
937045154 2:118847191-118847213 GGGGGCGGGGGCCGGCGCGGCGG - Exonic
939969618 2:148644820-148644842 GGAGGCGGCCGCGGGCGCGGGGG + Intronic
941666169 2:168246556-168246578 GGCGGCGCACCCTGGCACGGAGG + Intronic
941812637 2:169768921-169768943 GGCGGCGCGCCCCGACCCGGAGG + Intronic
942653756 2:178194424-178194446 GGCGGGGCGCGCTGGCGGGGCGG - Intergenic
946311327 2:218883901-218883923 GCCGGCGCTCACCGCCGCCGCGG + Intronic
946362821 2:219229347-219229369 GGGGGCGCGCGCGGGCGCCGGGG - Exonic
947472496 2:230412098-230412120 GGCGGGCCTCGCCGGCTAGGTGG + Intergenic
947593002 2:231395781-231395803 GGCGGCCCGGGCCGGAGCGGCGG - Exonic
947800975 2:232928336-232928358 GTCGGGGCACGGCGGCGCGGGGG - Intronic
948590853 2:239048968-239048990 GGCGGCGCTCGCCTGGCCCGTGG + Exonic
948645228 2:239400442-239400464 GGCTTCGCCCGCCGGGGCGGGGG - Exonic
1168800868 20:642541-642563 GGCGGCGCTCGCAGTTCCGGAGG + Intergenic
1169164063 20:3407523-3407545 GGCAGCCCCTGCCGGCGCGGGGG + Exonic
1171444790 20:25195766-25195788 GGTGGCGCCGGCCGGGGCGGGGG + Exonic
1172350076 20:34231385-34231407 GGCGGCGCTCGCCGGCGCGGCGG + Intronic
1172841222 20:37903587-37903609 GGCGCCCCCTGCCGGCGCGGTGG + Intronic
1173495306 20:43514109-43514131 GGCGGGGCTTGCAGGCCCGGAGG + Intronic
1173672911 20:44810412-44810434 TGCGGGGCTGGCGGGCGCGGCGG + Intergenic
1174607025 20:51768435-51768457 GCCGGCGGGCGGCGGCGCGGAGG - Exonic
1175847112 20:62065016-62065038 GGCGGCGGGCGCGGGGGCGGCGG + Exonic
1175873685 20:62219910-62219932 GGGGGCGCTGGCGGGCGAGGCGG - Exonic
1176380685 21:6111013-6111035 GGCGGCCCCCGCCCGGGCGGCGG + Intergenic
1176548483 21:8211939-8211961 GGCGGCGCGGAGCGGCGCGGCGG - Intergenic
1176556377 21:8256147-8256169 GGCGGCGCGGAGCGGCGCGGCGG - Intergenic
1176567414 21:8394974-8394996 GGCGGCGCGGAGCGGCGCGGCGG - Intergenic
1176575316 21:8439189-8439211 GGCGGCGCGGAGCGGCGCGGCGG - Intergenic
1178707899 21:34889762-34889784 GGCAGCGCACGCCGGACCGGGGG - Intronic
1179209248 21:39312614-39312636 GGCGGCGCGGGGCGGAGCGGTGG - Intronic
1179742787 21:43427227-43427249 GGCGGCCCCCGCCCGGGCGGCGG - Intergenic
1179968236 21:44818746-44818768 GCCCGCGCTCGCCGACGTGGCGG - Intronic
1180649977 22:17369589-17369611 GGCGGGGGGCGGCGGCGCGGGGG - Exonic
1182692902 22:32176170-32176192 GGCAGCGCTTGGCGGAGCGGCGG - Intergenic
1183050513 22:35257510-35257532 GGCGGCGATCGGCGGCGTTGAGG + Exonic
1183093776 22:35540551-35540573 GGCGACGCTCGCAGGGGCGCGGG + Intergenic
1183841650 22:40502762-40502784 GGCGGCGCTCGCCGGCGCGGCGG + Intronic
1183845092 22:40536390-40536412 GGCGGCGCTCGCCGGCGCCGCGG - Intronic
1184465782 22:44668473-44668495 GGCGGCGCCCGCCGGGGCAGGGG - Intergenic
1184557383 22:45240731-45240753 GGCGCCGCCCGCAGGCTCGGGGG + Intronic
1184680783 22:46071332-46071354 GACGGCGCGCGCGGGCGGGGCGG - Intronic
1203253367 22_KI270733v1_random:128244-128266 GGCGGCGCGGAGCGGCGCGGCGG - Intergenic
1203261421 22_KI270733v1_random:173322-173344 GGCGGCGCGGAGCGGCGCGGCGG - Intergenic
950036583 3:9890510-9890532 GGCGGGGCTGGGCGGGGCGGGGG + Intergenic
950253883 3:11488355-11488377 GGCGGCACTCGCCGGCGCGGCGG + Intronic
952382923 3:32818308-32818330 GGCGGCGGGCGGCGGCGCGGCGG + Exonic
954063633 3:48088956-48088978 GGCGGCGCTCGCCGGGTAGGCGG - Exonic
954080506 3:48210814-48210836 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
954194785 3:48990160-48990182 CGCGGCGCTCGCGGGCCTGGCGG + Exonic
955297206 3:57746908-57746930 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
956270195 3:67443337-67443359 AGGGGCGCTCGCCGGCGCGGCGG - Intronic
959042481 3:101438819-101438841 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
961688334 3:128650726-128650748 GGAGGCGCTGCCCGGCGCCGGGG + Exonic
961827446 3:129606498-129606520 GGCGGCGCGGGCCGGCGCCCTGG - Exonic
962793964 3:138834964-138834986 GGCGGCGCAGGGCGGGGCGGGGG - Intergenic
963202132 3:142596582-142596604 GGGGGCGCGCGGCGGCTCGGGGG + Intronic
968178183 3:196569021-196569043 GGCGGCGCTGGCTGTAGCGGCGG + Exonic
968372878 4:11600-11622 GGAGACGCACGCCAGCGCGGGGG + Intergenic
968498553 4:932394-932416 GGCTGCGCGCGCAGGCGCGGAGG + Exonic
968659784 4:1794177-1794199 GGCCGCGCTCTCCGGCAAGGAGG - Intronic
969413282 4:7043239-7043261 GGCGGCGGTGGCCGGCGCGGGGG + Intronic
971405620 4:26319469-26319491 GGCGGCGGGCGCGGGCGGGGTGG - Intronic
971757564 4:30721996-30722018 GGCGGCGAGAGCCGGCGCGCCGG + Exonic
972671472 4:41216446-41216468 GGCGGCGCGCGCAGGCGCAGAGG + Intronic
975779059 4:77819925-77819947 GGCCGCGGCCGCCGGCGCGAAGG + Intergenic
975983605 4:80184294-80184316 GGCAGCGTTCCCCGGGGCGGGGG - Intronic
976177971 4:82373609-82373631 GGCGGCGGTAGGCGGCTCGGCGG - Exonic
979349267 4:119627306-119627328 GGCGACGGGCGGCGGCGCGGAGG - Intronic
980463560 4:133148211-133148233 GGCGGCGAACGCGGGCGGGGTGG - Intergenic
982616119 4:157637803-157637825 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
985129710 4:186726929-186726951 GCCCGCGCTCGCCGGCGCCCGGG - Intergenic
985462518 4:190120967-190120989 GGAGACGCACGCCAGCGCGGGGG - Intergenic
986152554 5:5140490-5140512 GGCGGGGCTTGGCGGCGCTGTGG + Exonic
986321014 5:6632953-6632975 GGCGGCGGTCGCGGGGTCGGCGG - Exonic
987050475 5:14143775-14143797 AGCCGCGCTGGCCGCCGCGGCGG - Exonic
987340448 5:16935475-16935497 GGCGGCGCGCGCCGGGGCGCGGG - Intronic
992105518 5:73447202-73447224 GGCGGCGGCGGCCTGCGCGGCGG + Exonic
992373700 5:76171026-76171048 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
992530136 5:77645305-77645327 GGCGGCGCGGGCCGGCTGGGGGG - Intergenic
998133167 5:139661159-139661181 GGCGGCGCGGGCAGCCGCGGCGG - Intronic
1000014737 5:157266636-157266658 GGCGGCTCTCGCTGGCCCTGGGG - Intronic
1000985227 5:167858796-167858818 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
1002006405 5:176238338-176238360 GGCGGGGCTTGGCGGCCCGGCGG + Intergenic
1002021154 5:176365361-176365383 TGGGGCGCTGGCCGGCGCGCGGG - Intergenic
1002219975 5:177672299-177672321 GGCGGGGCTTGGCGGCCCGGCGG - Intergenic
1002341432 5:178518852-178518874 GGCGGCGCTCGCCGGCGCGGCGG + Intronic
1002512746 5:179733351-179733373 GGCGGCGGGCGCCGGGGCCGTGG - Exonic
1003049414 6:2766048-2766070 GCCGGCGGCCGCCGCCGCGGCGG + Exonic
1003078052 6:2999775-2999797 GGCGGGGCTCGGGGGCGGGGCGG + Intronic
1003078065 6:2999804-2999826 GGCGGGGCTCACGGGCGGGGCGG + Intronic
1004387928 6:15188413-15188435 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1004441924 6:15662562-15662584 GGAGGCGCTCGGCGGCGCAGCGG - Intronic
1006434151 6:34017484-34017506 CGCGGCGCTCGCGGGCTTGGCGG - Intergenic
1006472699 6:34237445-34237467 GGCGGCGCGAGCCGGCGGCGGGG + Intronic
1006492110 6:34396946-34396968 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
1006665278 6:35688886-35688908 GGCGGCGGTGTCCGGCGCGCGGG - Intronic
1006860706 6:37170124-37170146 GGAGGAGCGCGCCGGCGGGGAGG - Intergenic
1007674448 6:43581602-43581624 GGCGGCGCTCGCCGGCGCGGCGG + Intronic
1010969318 6:82247445-82247467 GGCTGCGGACGGCGGCGCGGGGG - Intronic
1013231739 6:108166684-108166706 GGCGGCGCCCGGCGGCGAGGCGG + Intronic
1015149268 6:130019983-130020005 GGCGGCGGTCGCGGCGGCGGCGG + Intronic
1015476519 6:133664256-133664278 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1016328221 6:142926995-142927017 GGCAGCGCGCGGCGGCGCGGCGG + Intronic
1016658069 6:146543734-146543756 GGCGGCGTCAGCGGGCGCGGCGG + Exonic
1017073765 6:150599968-150599990 GGCGGCGCTCGCAGGTCGGGCGG - Exonic
1017470431 6:154733359-154733381 GGGCGCGCTAGCCGGCGCCGCGG + Exonic
1017696610 6:157021862-157021884 GGCGGCGCGAGACGGCGCAGGGG - Intronic
1018686339 6:166307527-166307549 GGCGGCCCTGGCCGGCGGTGGGG + Exonic
1019436988 7:1027677-1027699 GGCGGCCCCCACTGGCGCGGTGG - Intronic
1020616648 7:10466477-10466499 GGCGGCGCTCGCTGGCGCGGCGG + Intergenic
1021451133 7:20784853-20784875 GTCGCCGCTGGCCGGCGCGGGGG - Exonic
1021872128 7:25017921-25017943 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1024521075 7:50304501-50304523 GGCGGGGGCGGCCGGCGCGGAGG + Intronic
1025916843 7:65873126-65873148 GAAGGCGCGCGCGGGCGCGGAGG - Intergenic
1028417585 7:90596369-90596391 GGCCGCGCTCGCCGCCGCCGTGG - Intronic
1029640406 7:101816408-101816430 GGCGGCGCTGGCGGCGGCGGCGG - Intronic
1030216158 7:107045183-107045205 GGCGGCGCCCGCGGACGCAGGGG + Exonic
1031317257 7:120273316-120273338 GAAGGCGCTCGGCAGCGCGGGGG - Intergenic
1032306194 7:130734044-130734066 GACGGCGCTCGCCGGCGGCCGGG - Exonic
1033159127 7:138981355-138981377 GGCGCCGCGCACCGGCGCGGAGG + Intergenic
1034866818 7:154649051-154649073 GGCAGCGCTCGCCTGGGTGGAGG - Intronic
1035508125 8:150639-150661 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
1036454221 8:8893472-8893494 GGCGGCGCTCGGCCCGGCGGCGG + Exonic
1036536889 8:9658350-9658372 GGCGGCGCTCGCCGGCGCGGCGG + Intronic
1036785309 8:11681481-11681503 TGCGGCGCTCGCGGGGGGGGGGG + Intronic
1037575273 8:20197176-20197198 GGAGGCGCGCGCGGGCGCAGAGG - Intergenic
1038828419 8:31032733-31032755 GGCGGCGGCCGCGGCCGCGGAGG - Exonic
1039996746 8:42541301-42541323 GGCGGGGCTCGCGGCGGCGGCGG - Intronic
1041244762 8:55879845-55879867 GGCAGCGCGGCCCGGCGCGGCGG - Exonic
1042040039 8:64580742-64580764 GGCGGCGGCAGCGGGCGCGGCGG + Exonic
1042048797 8:64685151-64685173 GGCGGCGCTCGCCGGCGGGGCGG - Intronic
1042785090 8:72537372-72537394 GGCGGCGGCCGCGGGGGCGGAGG - Exonic
1044660451 8:94590181-94590203 GGCGGCGCTCGCCAGCGCGGCGG - Intergenic
1047687103 8:127315846-127315868 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1047848287 8:128827176-128827198 GGCGGCGCTCGCCGGCACGGCGG + Intergenic
1048553888 8:135457318-135457340 GGCGGCGGGCGGCGGGGCGGTGG + Intergenic
1053256052 9:36616064-36616086 GGCGGCGCTCGCCGGCGCGGTGG + Intronic
1053457053 9:38241517-38241539 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1053906974 9:42852281-42852303 GGCGGCGCGCGCCGGCAGGTGGG - Intergenic
1054274348 9:63053172-63053194 GGCGGAGAGCGGCGGCGCGGCGG + Intergenic
1054274352 9:63053190-63053212 GGCGGAGAGCGGCGGCGCGGCGG + Intergenic
1054368739 9:64369334-64369356 GGCGGCGCGCGCCTGCACCGCGG - Intergenic
1054400471 9:64711738-64711760 GGCGGAGAGCGGCGGCGCGGCGG - Intergenic
1054400475 9:64711756-64711778 GGCGGAGAGCGGCGGCGCGGCGG - Intergenic
1054527979 9:66153173-66153195 GGCGGCGCGCGCCTGCACCGCGG + Intergenic
1057869924 9:98709427-98709449 GGCAGCGCTCGGCGGAGCGGCGG - Intergenic
1059210845 9:112513677-112513699 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
1060064764 9:120495030-120495052 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
1060544760 9:124453383-124453405 GGCGGCGCGCTGGGGCGCGGGGG + Exonic
1061028980 9:128068351-128068373 GGCGGCGTCCGGCGGCGGGGAGG - Exonic
1061084952 9:128393204-128393226 GGCGGCGGTGGCCCGGGCGGCGG + Intergenic
1061984105 9:134119092-134119114 GGCGGCGCTCGCCGGCGCAGCGG + Intergenic
1062162599 9:135088284-135088306 GGCGTCGCGGGCCGGCGCAGCGG + Intronic
1062305741 9:135906623-135906645 GGCGCCGCTTCCCGGCGCGCCGG - Intronic
1062621397 9:137423874-137423896 GGCCGCGCTGGGGGGCGCGGCGG + Intronic
1203469767 Un_GL000220v1:111391-111413 GGCGGCGCGGAGCGGCGCGGCGG - Intergenic
1203477588 Un_GL000220v1:155363-155385 GGCGGCGCGGAGCGGCGCGGCGG - Intergenic
1187172999 X:16869999-16870021 GGCGGCGCGCGCCGGGGCCGCGG - Intronic
1187281376 X:17860787-17860809 GGCGGCGCCGGCCGGCGGGGCGG - Intronic
1187464440 X:19515138-19515160 GGCGGAGCCCGACGGGGCGGCGG - Exonic
1187507094 X:19887107-19887129 GGCGCCGCGCGCGGGCTCGGCGG + Intronic
1191618327 X:63190365-63190387 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
1192621065 X:72680811-72680833 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
1195036336 X:100973423-100973445 GGCGGCGCTCGCCGGCGCGGCGG + Intronic
1197753607 X:129981007-129981029 GGAGGCCCGCGGCGGCGCGGCGG + Intergenic