ID: 959421696

View in Genome Browser
Species Human (GRCh38)
Location 3:106136268-106136290
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959421696_959421703 15 Left 959421696 3:106136268-106136290 CCACCCATTGGAATGTAGTGACC No data
Right 959421703 3:106136306-106136328 CCTCAGCCTCCCAAACTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959421696 Original CRISPR GGTCACTACATTCCAATGGG TGG (reversed) Intergenic
No off target data available for this crispr