ID: 959425578

View in Genome Browser
Species Human (GRCh38)
Location 3:106183586-106183608
Sequence GAAATTGAAGCTGAGACTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959425578_959425582 9 Left 959425578 3:106183586-106183608 CCTGAAGTCTCAGCTTCAATTTC No data
Right 959425582 3:106183618-106183640 ATTTATCAATCGGTGTCCTTGGG No data
959425578_959425581 8 Left 959425578 3:106183586-106183608 CCTGAAGTCTCAGCTTCAATTTC No data
Right 959425581 3:106183617-106183639 CATTTATCAATCGGTGTCCTTGG No data
959425578_959425579 -1 Left 959425578 3:106183586-106183608 CCTGAAGTCTCAGCTTCAATTTC No data
Right 959425579 3:106183608-106183630 CTAGTGCACCATTTATCAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959425578 Original CRISPR GAAATTGAAGCTGAGACTTC AGG (reversed) Intergenic
No off target data available for this crispr