ID: 959425579

View in Genome Browser
Species Human (GRCh38)
Location 3:106183608-106183630
Sequence CTAGTGCACCATTTATCAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959425578_959425579 -1 Left 959425578 3:106183586-106183608 CCTGAAGTCTCAGCTTCAATTTC No data
Right 959425579 3:106183608-106183630 CTAGTGCACCATTTATCAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959425579 Original CRISPR CTAGTGCACCATTTATCAAT CGG Intergenic
No off target data available for this crispr