ID: 959426232

View in Genome Browser
Species Human (GRCh38)
Location 3:106192458-106192480
Sequence TGCTGATGGCAGACAGGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959426232_959426239 8 Left 959426232 3:106192458-106192480 CCCTAGCCTGTCTGCCATCAGCA No data
Right 959426239 3:106192489-106192511 GTTCAGCATTTTCTGGTTTCAGG No data
959426232_959426238 1 Left 959426232 3:106192458-106192480 CCCTAGCCTGTCTGCCATCAGCA No data
Right 959426238 3:106192482-106192504 CTTGGGAGTTCAGCATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959426232 Original CRISPR TGCTGATGGCAGACAGGCTA GGG (reversed) Intergenic
No off target data available for this crispr