ID: 959426744

View in Genome Browser
Species Human (GRCh38)
Location 3:106199006-106199028
Sequence GTTTCAATTGGGAAACAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959426739_959426744 8 Left 959426739 3:106198975-106198997 CCTTTTTTTGGCTGCTGTCTCAA No data
Right 959426744 3:106199006-106199028 GTTTCAATTGGGAAACAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959426744 Original CRISPR GTTTCAATTGGGAAACAGAG GGG Intergenic
No off target data available for this crispr