ID: 959428354

View in Genome Browser
Species Human (GRCh38)
Location 3:106221018-106221040
Sequence GCTGTGAGTCTGTCACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959428351_959428354 3 Left 959428351 3:106220992-106221014 CCTCTTTGTACCTGTGGTAGAAT 0: 64
1: 2864
2: 7752
3: 2926
4: 974
Right 959428354 3:106221018-106221040 GCTGTGAGTCTGTCACATCCTGG No data
959428353_959428354 -7 Left 959428353 3:106221002-106221024 CCTGTGGTAGAATTCGGCTGTGA 0: 72
1: 5485
2: 5426
3: 2344
4: 934
Right 959428354 3:106221018-106221040 GCTGTGAGTCTGTCACATCCTGG No data
959428349_959428354 9 Left 959428349 3:106220986-106221008 CCAGCTCCTCTTTGTACCTGTGG 0: 49
1: 2369
2: 4237
3: 6033
4: 2714
Right 959428354 3:106221018-106221040 GCTGTGAGTCTGTCACATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959428354 Original CRISPR GCTGTGAGTCTGTCACATCC TGG Intergenic
No off target data available for this crispr