ID: 959429414

View in Genome Browser
Species Human (GRCh38)
Location 3:106234562-106234584
Sequence CCACCTAAACAGCTCTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959429406_959429414 17 Left 959429406 3:106234522-106234544 CCCTCTGAAACCCATCCTAATAG No data
Right 959429414 3:106234562-106234584 CCACCTAAACAGCTCTTCCCAGG No data
959429408_959429414 7 Left 959429408 3:106234532-106234554 CCCATCCTAATAGCTTTCGCCTC No data
Right 959429414 3:106234562-106234584 CCACCTAAACAGCTCTTCCCAGG No data
959429405_959429414 24 Left 959429405 3:106234515-106234537 CCACATTCCCTCTGAAACCCATC No data
Right 959429414 3:106234562-106234584 CCACCTAAACAGCTCTTCCCAGG No data
959429409_959429414 6 Left 959429409 3:106234533-106234555 CCATCCTAATAGCTTTCGCCTCC No data
Right 959429414 3:106234562-106234584 CCACCTAAACAGCTCTTCCCAGG No data
959429410_959429414 2 Left 959429410 3:106234537-106234559 CCTAATAGCTTTCGCCTCCAACA No data
Right 959429414 3:106234562-106234584 CCACCTAAACAGCTCTTCCCAGG No data
959429407_959429414 16 Left 959429407 3:106234523-106234545 CCTCTGAAACCCATCCTAATAGC No data
Right 959429414 3:106234562-106234584 CCACCTAAACAGCTCTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959429414 Original CRISPR CCACCTAAACAGCTCTTCCC AGG Intergenic
No off target data available for this crispr