ID: 959433282

View in Genome Browser
Species Human (GRCh38)
Location 3:106282355-106282377
Sequence GATTTGCTCTGAAGTCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959433279_959433282 30 Left 959433279 3:106282302-106282324 CCTACAATCTAGGTGAGAGACGA No data
Right 959433282 3:106282355-106282377 GATTTGCTCTGAAGTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959433282 Original CRISPR GATTTGCTCTGAAGTCAGCC TGG Intergenic