ID: 959438552

View in Genome Browser
Species Human (GRCh38)
Location 3:106348176-106348198
Sequence GGTTCTATTGGCTGAAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959438552_959438554 -4 Left 959438552 3:106348176-106348198 CCTTCTTTTCAGCCAATAGAACC No data
Right 959438554 3:106348195-106348217 AACCATTGTTCAAGTGACGAAGG No data
959438552_959438556 25 Left 959438552 3:106348176-106348198 CCTTCTTTTCAGCCAATAGAACC No data
Right 959438556 3:106348224-106348246 ACAGTTTAGAAAGCATTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959438552 Original CRISPR GGTTCTATTGGCTGAAAAGA AGG (reversed) Intergenic
No off target data available for this crispr