ID: 959438918

View in Genome Browser
Species Human (GRCh38)
Location 3:106352457-106352479
Sequence GAGGGTGAAGAATGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959438918_959438923 -10 Left 959438918 3:106352457-106352479 CCTTCCTCCCATTCTTCACCCTC No data
Right 959438923 3:106352470-106352492 CTTCACCCTCAAGTAGGCCCTGG 0: 16
1: 144
2: 335
3: 434
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959438918 Original CRISPR GAGGGTGAAGAATGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr