ID: 959438918 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:106352457-106352479 |
| Sequence | GAGGGTGAAGAATGGGAGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 959438918_959438923 | -10 | Left | 959438918 | 3:106352457-106352479 | CCTTCCTCCCATTCTTCACCCTC | No data | ||
| Right | 959438923 | 3:106352470-106352492 | CTTCACCCTCAAGTAGGCCCTGG | 0: 16 1: 144 2: 335 3: 434 4: 529 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 959438918 | Original CRISPR | GAGGGTGAAGAATGGGAGGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||