ID: 959439505

View in Genome Browser
Species Human (GRCh38)
Location 3:106359151-106359173
Sequence GTTATCTGCAGAAGACGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959439505_959439508 5 Left 959439505 3:106359151-106359173 CCCTGCCGTCTTCTGCAGATAAC No data
Right 959439508 3:106359179-106359201 TCCTTTTGAGAGACAACGCTTGG No data
959439505_959439511 23 Left 959439505 3:106359151-106359173 CCCTGCCGTCTTCTGCAGATAAC No data
Right 959439511 3:106359197-106359219 CTTGGCCTTTTACTGGCCTTTGG No data
959439505_959439512 26 Left 959439505 3:106359151-106359173 CCCTGCCGTCTTCTGCAGATAAC No data
Right 959439512 3:106359200-106359222 GGCCTTTTACTGGCCTTTGGTGG No data
959439505_959439510 16 Left 959439505 3:106359151-106359173 CCCTGCCGTCTTCTGCAGATAAC No data
Right 959439510 3:106359190-106359212 GACAACGCTTGGCCTTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959439505 Original CRISPR GTTATCTGCAGAAGACGGCA GGG (reversed) Intergenic
No off target data available for this crispr