ID: 959439506

View in Genome Browser
Species Human (GRCh38)
Location 3:106359152-106359174
Sequence AGTTATCTGCAGAAGACGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959439506_959439510 15 Left 959439506 3:106359152-106359174 CCTGCCGTCTTCTGCAGATAACT No data
Right 959439510 3:106359190-106359212 GACAACGCTTGGCCTTTTACTGG No data
959439506_959439512 25 Left 959439506 3:106359152-106359174 CCTGCCGTCTTCTGCAGATAACT No data
Right 959439512 3:106359200-106359222 GGCCTTTTACTGGCCTTTGGTGG No data
959439506_959439511 22 Left 959439506 3:106359152-106359174 CCTGCCGTCTTCTGCAGATAACT No data
Right 959439511 3:106359197-106359219 CTTGGCCTTTTACTGGCCTTTGG No data
959439506_959439508 4 Left 959439506 3:106359152-106359174 CCTGCCGTCTTCTGCAGATAACT No data
Right 959439508 3:106359179-106359201 TCCTTTTGAGAGACAACGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959439506 Original CRISPR AGTTATCTGCAGAAGACGGC AGG (reversed) Intergenic
No off target data available for this crispr