ID: 959439508

View in Genome Browser
Species Human (GRCh38)
Location 3:106359179-106359201
Sequence TCCTTTTGAGAGACAACGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959439505_959439508 5 Left 959439505 3:106359151-106359173 CCCTGCCGTCTTCTGCAGATAAC No data
Right 959439508 3:106359179-106359201 TCCTTTTGAGAGACAACGCTTGG No data
959439506_959439508 4 Left 959439506 3:106359152-106359174 CCTGCCGTCTTCTGCAGATAACT No data
Right 959439508 3:106359179-106359201 TCCTTTTGAGAGACAACGCTTGG No data
959439507_959439508 0 Left 959439507 3:106359156-106359178 CCGTCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 959439508 3:106359179-106359201 TCCTTTTGAGAGACAACGCTTGG No data
959439504_959439508 27 Left 959439504 3:106359129-106359151 CCTCTAGGATTTTAGAGCAAAGC No data
Right 959439508 3:106359179-106359201 TCCTTTTGAGAGACAACGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959439508 Original CRISPR TCCTTTTGAGAGACAACGCT TGG Intergenic
No off target data available for this crispr