ID: 959441696

View in Genome Browser
Species Human (GRCh38)
Location 3:106384293-106384315
Sequence CCTGGTAATGATAAAGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959441696_959441701 25 Left 959441696 3:106384293-106384315 CCAGCAACTTTATCATTACCAGG No data
Right 959441701 3:106384341-106384363 AGGCCCCTAACCCAGATTTCTGG No data
959441696_959441699 5 Left 959441696 3:106384293-106384315 CCAGCAACTTTATCATTACCAGG No data
Right 959441699 3:106384321-106384343 TGTTAGATATGCAAAGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959441696 Original CRISPR CCTGGTAATGATAAAGTTGC TGG (reversed) Intergenic
No off target data available for this crispr