ID: 959460698

View in Genome Browser
Species Human (GRCh38)
Location 3:106622268-106622290
Sequence CAGTCTAAGGCGTTGCATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959460698_959460703 -4 Left 959460698 3:106622268-106622290 CCTGAATGCAACGCCTTAGACTG No data
Right 959460703 3:106622287-106622309 ACTGGATTGGATCTTGGACTTGG No data
959460698_959460702 -10 Left 959460698 3:106622268-106622290 CCTGAATGCAACGCCTTAGACTG No data
Right 959460702 3:106622281-106622303 CCTTAGACTGGATTGGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959460698 Original CRISPR CAGTCTAAGGCGTTGCATTC AGG (reversed) Intergenic
No off target data available for this crispr