ID: 959460698 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:106622268-106622290 |
| Sequence | CAGTCTAAGGCGTTGCATTC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 959460698_959460703 | -4 | Left | 959460698 | 3:106622268-106622290 | CCTGAATGCAACGCCTTAGACTG | No data | ||
| Right | 959460703 | 3:106622287-106622309 | ACTGGATTGGATCTTGGACTTGG | No data | ||||
| 959460698_959460702 | -10 | Left | 959460698 | 3:106622268-106622290 | CCTGAATGCAACGCCTTAGACTG | No data | ||
| Right | 959460702 | 3:106622281-106622303 | CCTTAGACTGGATTGGATCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 959460698 | Original CRISPR | CAGTCTAAGGCGTTGCATTC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||