ID: 959461215

View in Genome Browser
Species Human (GRCh38)
Location 3:106628290-106628312
Sequence ACACCTTGATGTCAACCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959461211_959461215 4 Left 959461211 3:106628263-106628285 CCTCAGATGAAAACCCAGCCATG No data
Right 959461215 3:106628290-106628312 ACACCTTGATGTCAACCTTGTGG No data
959461213_959461215 -10 Left 959461213 3:106628277-106628299 CCAGCCATGATCAACACCTTGAT No data
Right 959461215 3:106628290-106628312 ACACCTTGATGTCAACCTTGTGG No data
959461212_959461215 -9 Left 959461212 3:106628276-106628298 CCCAGCCATGATCAACACCTTGA No data
Right 959461215 3:106628290-106628312 ACACCTTGATGTCAACCTTGTGG No data
959461209_959461215 24 Left 959461209 3:106628243-106628265 CCTCAGAAGAGGACTCTGACCCT No data
Right 959461215 3:106628290-106628312 ACACCTTGATGTCAACCTTGTGG No data
959461210_959461215 5 Left 959461210 3:106628262-106628284 CCCTCAGATGAAAACCCAGCCAT No data
Right 959461215 3:106628290-106628312 ACACCTTGATGTCAACCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959461215 Original CRISPR ACACCTTGATGTCAACCTTG TGG Intergenic