ID: 959464980

View in Genome Browser
Species Human (GRCh38)
Location 3:106674703-106674725
Sequence TGGCCTGCAATCAGTCTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 612
Summary {0: 19, 1: 57, 2: 114, 3: 152, 4: 270}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959464980_959464984 10 Left 959464980 3:106674703-106674725 CCAATCAGACTGATTGCAGGCCA 0: 19
1: 57
2: 114
3: 152
4: 270
Right 959464984 3:106674736-106674758 TGCATTGGGTGTACAACAAGTGG No data
959464980_959464982 -4 Left 959464980 3:106674703-106674725 CCAATCAGACTGATTGCAGGCCA 0: 19
1: 57
2: 114
3: 152
4: 270
Right 959464982 3:106674722-106674744 GCCATTACTTCATTTGCATTGGG No data
959464980_959464985 17 Left 959464980 3:106674703-106674725 CCAATCAGACTGATTGCAGGCCA 0: 19
1: 57
2: 114
3: 152
4: 270
Right 959464985 3:106674743-106674765 GGTGTACAACAAGTGGCCAATGG No data
959464980_959464981 -5 Left 959464980 3:106674703-106674725 CCAATCAGACTGATTGCAGGCCA 0: 19
1: 57
2: 114
3: 152
4: 270
Right 959464981 3:106674721-106674743 GGCCATTACTTCATTTGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959464980 Original CRISPR TGGCCTGCAATCAGTCTGAT TGG (reversed) Intergenic
900653197 1:3741342-3741364 CAGCCTGTAATCAGTCTGATTGG - Intergenic
900682066 1:3922317-3922339 CGACCTGCAACCAGTCTGATTGG + Intergenic
900982565 1:6054719-6054741 TGGCCTGTGATCATTCTGATTGG + Intronic
901528911 1:9841698-9841720 TGGCCAGGACTCAGGCTGATGGG + Intergenic
901554241 1:10019020-10019042 TGGCCTGTAATCAGTCCGATTGG - Intergenic
902032786 1:13434834-13434856 TGGCCCACAATCAGTCTGATTGG - Intergenic
902541207 1:17156335-17156357 TGGCCAGCAATCAGTCTGATTGG - Intergenic
904734314 1:32618902-32618924 TGGCCCACGACCAGTCTGATTGG - Intronic
905746186 1:40420296-40420318 TGGAATGCTATAAGTCTGATGGG + Intronic
907027260 1:51132839-51132861 AGGTCTGCAGTTAGTCTGATGGG - Intronic
907181206 1:52571830-52571852 TGGCCTGAGACCAGCCTGATTGG - Intergenic
907181223 1:52572051-52572073 TGGCCTGTGATTAATCTGATTGG - Intergenic
907183258 1:52589277-52589299 TGGCCCAAAATTAGTCTGATTGG - Intergenic
907378430 1:54064509-54064531 TGGCCTGCAACCAGTATGATTGG + Intronic
909498165 1:76303032-76303054 TGGTCTGCAACCAGTCCGATTGG + Intronic
909498175 1:76303175-76303197 TGGCCCACAATCAGTCTGATTGG + Intronic
909706776 1:78594733-78594755 AGGCCTGTGATCAGTCTGATTGG - Intergenic
909706797 1:78594895-78594917 TGGCCAGCAACCAGTCTAAGTGG - Intergenic
909741902 1:79039237-79039259 TAGCCCACAATCAGTCTGATTGG + Intergenic
910734950 1:90443459-90443481 TGGCCCGCCACCAGTCTGATCGG + Intergenic
911211486 1:95143016-95143038 TGGCTGGCAGTCAGTCAGATTGG + Intronic
911809937 1:102263133-102263155 TGGCCTGTGATCAGTCTGATTGG - Intergenic
911809944 1:102263214-102263236 TGGCCTTCAACCAGTCTGATTGG - Intergenic
912514603 1:110210209-110210231 GGGCCTGCAGTGAGTCGGATCGG + Intergenic
915744856 1:158148050-158148072 TGGCCCACAATCAGTCTGATTGG - Intergenic
915862838 1:159465454-159465476 TAGCTTGCCATCAGTCTGATTGG - Intergenic
916917999 1:169430878-169430900 TGGCCCGCAATCAGTCTGATTGG + Intronic
917924189 1:179775179-179775201 TGGCCTACAAACGGTCTGATTGG + Intronic
917924201 1:179775342-179775364 TAGTCTACAATCAGTCTGATTGG + Intronic
919069808 1:192739694-192739716 TTGCCGGCAATCAGTTTGATTGG - Intergenic
920781250 1:208993205-208993227 AGATCTGCTATCAGTCTGATGGG - Intergenic
920899228 1:210089987-210090009 GGGCCTGTGACCAGTCTGATTGG + Intronic
921982762 1:221276001-221276023 TAGCCTGCAATCAGTCTGAGTGG - Intergenic
922167576 1:223128717-223128739 TCACCTGCAGTCAGTCTGATTGG - Intronic
922968955 1:229717914-229717936 TAGCTCACAATCAGTCTGATTGG + Intergenic
922968968 1:229718077-229718099 TGGCCTGCAACCAGTCTGATAGG + Intergenic
923172781 1:231432218-231432240 TGGCCCGCAATCAGTCTGATTGG + Intergenic
923633243 1:235669608-235669630 TATCCCACAATCAGTCTGATGGG - Intronic
924251049 1:242133277-242133299 TGGCCCACAACCAGTCTGATTGG - Intronic
924629749 1:245725469-245725491 AGGTCTGCTATGAGTCTGATGGG - Intergenic
1063080224 10:2760839-2760861 TGGCCAGAGACCAGTCTGATTGG - Intergenic
1064351977 10:14584847-14584869 TGGCCTGTGACCAGCCTGATTGG - Intronic
1064377774 10:14812521-14812543 TGGCCCATGATCAGTCTGATTGG - Intergenic
1065701461 10:28429882-28429904 TAGCCTGCAATCAGTCTGATTGG + Intergenic
1065701473 10:28430039-28430061 TGGCCTACAATCAGTCTGATTGG + Intergenic
1065781633 10:29174435-29174457 TAGCCCACAACCAGTCTGATTGG + Intergenic
1066270294 10:33815949-33815971 TGGCCCACAGTCAATCTGATTGG + Intergenic
1067246306 10:44549372-44549394 TGGCCGGCAATCAGTCTGATTGG - Intergenic
1067283303 10:44889365-44889387 TGTCCTGTAATCAGTGTGGTGGG - Intergenic
1067825994 10:49573281-49573303 TGGCCTGCAATCACTATGATTGG + Intergenic
1068026315 10:51649834-51649856 TAGCCCGCAATCAGTCTGATTGG + Intronic
1068417273 10:56739993-56740015 TTGCCTGCAAACAGTCTGCTTGG - Intergenic
1069360337 10:67634108-67634130 TGGTCTGCTGTTAGTCTGATGGG - Intronic
1070278769 10:75033618-75033640 GGGCCTGGAAGCAATCTGATCGG + Intergenic
1070381147 10:75881631-75881653 TGGCCTGCAATCAGTCTCACTGG - Intronic
1070765257 10:79052698-79052720 TGGCCTCCAGTCAGGCTGAGAGG - Intergenic
1070833525 10:79434320-79434342 TGACCTGCGTTCAGCCTGATGGG + Intronic
1071317268 10:84414511-84414533 AGGTCTGCCATTAGTCTGATTGG + Intronic
1071870165 10:89785368-89785390 TGGCCTGCCACAAGCCTGATTGG + Intergenic
1072523162 10:96247731-96247753 TGGCCTGGGACCAGTCTGATTGG - Intronic
1072523172 10:96247812-96247834 TGGCCCACGACCAGTCTGATTGG - Intronic
1073357286 10:102867147-102867169 TGACCATCAATCATTCTGATTGG - Intronic
1073994571 10:109300900-109300922 TAGCCGGGAATCAGTCTGATAGG + Intergenic
1074438654 10:113455902-113455924 TGGCCCGTGACCAGTCTGATTGG + Intergenic
1074695791 10:116049357-116049379 TGGCATGCAATCAGTCTGGTTGG - Intergenic
1075155504 10:119973366-119973388 TGGCCTGCAACCAGTTTGATTGG + Intergenic
1075155511 10:119973447-119973469 TGGCCTACAACCAGTCTGATTGG + Intergenic
1076159576 10:128233203-128233225 TGGGGTGCATTCAGTCTGAAAGG + Intergenic
1076433775 10:130425803-130425825 TGGCCAGCTATCAGTGTGGTAGG + Intergenic
1076652840 10:132001787-132001809 CGGCCTGCAACCAGTCTGATTGG - Intergenic
1077409941 11:2399257-2399279 TGGCCTGCAAAGAGGCTGCTGGG - Intergenic
1077491065 11:2861302-2861324 TGGCCTGCCCTCAGTCTGCTAGG - Intergenic
1078387859 11:10908746-10908768 CGGCCTGCAATCATTTTGATTGG - Intergenic
1081013167 11:37841580-37841602 TGACCAGCAATCAGTCTGATTGG - Intergenic
1081722811 11:45302582-45302604 TGGCCCGCAATCAGTCTGACTGG + Intergenic
1082036730 11:47651132-47651154 TGGCCTGAAATGAGTCTTAAAGG + Intergenic
1082936436 11:58661542-58661564 TGGCCTGGAATCAGGCTAATTGG + Intronic
1082938089 11:58675150-58675172 TGTCCTGCCATAAGTCAGATTGG + Intronic
1082960788 11:58916964-58916986 TGGCCCACAAGCAGTTTGATTGG + Intronic
1082961613 11:58923435-58923457 TGGCCCGCAACCAGTTTGAATGG + Intronic
1083062637 11:59890640-59890662 AGGCCTGCTATTAGTCTGATGGG + Intergenic
1085333787 11:75674191-75674213 GGGCCTGCAGCCAGTCTGATTGG - Intergenic
1085357280 11:75850048-75850070 TGGCCTGCAATCAGTCTGATTGG + Intronic
1085483756 11:76844184-76844206 TGGCCCGCAATTAGTCTGTTTGG - Intergenic
1085581666 11:77656456-77656478 CGGCCGGCAAACAGTCTGATTGG - Intergenic
1086771502 11:90773504-90773526 AGGTCTGCTATTAGTCTGATGGG + Intergenic
1086792321 11:91057925-91057947 AGGTCTGCTGTCAGTCTGATGGG + Intergenic
1086987850 11:93269410-93269432 AGGTCTGCACTTAGTCTGATGGG + Intergenic
1088295275 11:108286545-108286567 TGGTCTGTAATCAGTCTGATTGG + Intronic
1089142387 11:116296304-116296326 TGGCCCACAGTCAGTCTGATTGG - Intergenic
1089385611 11:118065629-118065651 AGGACCACAATCAGTCTGATTGG - Intergenic
1089593022 11:119556896-119556918 AGGCCTGTGACCAGTCTGATTGG - Intergenic
1089593045 11:119557058-119557080 TGGCCTGCAACCAGTCTGATTGG - Intergenic
1090557925 11:127897254-127897276 TGGCCCACAACCAGTCTGATTGG - Intergenic
1092251521 12:6900975-6900997 AGGCCTGCTATCAGTCTGACTGG + Intronic
1092644362 12:10553175-10553197 TGGCCTGTGATCAGTCTGATTGG - Intergenic
1092644370 12:10553256-10553278 TGGCCTGTGATCAGTCTAATTGG - Intergenic
1092655304 12:10677796-10677818 TGGCCAGCAACCAGTCTGACTGG + Intergenic
1092655312 12:10677877-10677899 TGGCCTGCAACCAGTCTGATTGG + Intergenic
1092864637 12:12749484-12749506 CTGCCTGCAATCAGTCTGATTGG - Intronic
1092985238 12:13838716-13838738 TGGCCTGGAAGCAATCTAATAGG + Intronic
1093383167 12:18520080-18520102 AGGCCTGCTGTTAGTCTGATGGG + Intronic
1093522682 12:20068553-20068575 TGGCCCGCTGTTAGTCTGATGGG - Intergenic
1094555430 12:31494753-31494775 TGGCCCACGATCAGTCTGTTTGG - Intronic
1094605446 12:31945224-31945246 TGGCCAAGAACCAGTCTGATAGG + Intergenic
1094680952 12:32666570-32666592 TGGCCTGCAATAAGTCTGATTGG + Intergenic
1095166878 12:38983462-38983484 TGGCCCACAGTCAGTCTGACTGG + Intergenic
1095392075 12:41719449-41719471 TGGCCTGCAACCAGTCTGATTGG - Intergenic
1095486665 12:42692179-42692201 TTGCTGGCGATCAGTCTGATTGG - Intergenic
1095487011 12:42695709-42695731 TGGCCCACAATCAGTCTGATTGG - Intergenic
1095493697 12:42762468-42762490 TAGCTTGGAATCAGTGTGATTGG + Intergenic
1096289211 12:50326663-50326685 TAGCCTGCAATCAGTCTGATTGG - Intronic
1096434732 12:51579589-51579611 TGGCCTGCAATCAGTCTGATTGG + Intergenic
1096848874 12:54422731-54422753 TGGGCTGTAAAAAGTCTGATTGG + Intergenic
1097479185 12:60099794-60099816 TGGCCTGCAACCAGTCTGATTGG + Intergenic
1097978541 12:65713409-65713431 TGGTCTGAAGTGAGTCTGATGGG - Intergenic
1098543335 12:71684204-71684226 TAGCCCACAATCAGTCTGATTGG + Intronic
1098826932 12:75308236-75308258 TGGCCTGCAATCAGTCTAATTGG - Intronic
1099227797 12:79990689-79990711 CCGCCCGCAATCAGTCTGACTGG - Intergenic
1099227809 12:79990842-79990864 TAGCCCGCAATCAGTCTGATTGG - Intergenic
1100077475 12:90803072-90803094 TAGCCCTCAATCAGTCTGATTGG + Intergenic
1100572593 12:95857385-95857407 TGGCCCACAACCAGTCTGATTGG - Intergenic
1100661031 12:96699025-96699047 TAGCCCACAATCAGTCTGATTGG + Intronic
1100661044 12:96699186-96699208 TCGCCTGCAATCAGTCTGATTGG + Intronic
1101168482 12:102063198-102063220 TGGCCCACAATCAGTCTGATTGG + Intergenic
1101168496 12:102063361-102063383 TGGCCCGCAATCAGTCTGATTGG + Intergenic
1101519076 12:105465051-105465073 TGGCCAGTACTTAGTCTGATAGG + Intergenic
1101586147 12:106087780-106087802 CGGCCTGCAATCAGGCAGTTTGG + Intronic
1102590313 12:113951652-113951674 TGCCCTGTAATCAGTCTGCAAGG + Intronic
1104156155 12:126134928-126134950 AGGTCTGCTATTAGTCTGATAGG + Intergenic
1104279420 12:127360816-127360838 TGGCCTGGGACCAGTCTGATTGG - Intergenic
1105337385 13:19486647-19486669 TGGCCTGCAGCCAGTCTGCTGGG + Intronic
1105404302 13:20120682-20120704 TGGCCCACAATCAAGCTGATTGG + Intergenic
1106601567 13:31191959-31191981 TGACCCGCAATCAGTCTGACTGG - Intergenic
1107407674 13:40129755-40129777 TGGCCTGCGACCAGCCTGATTGG + Intergenic
1108173788 13:47771864-47771886 AGGTCTGCTATTAGTCTGATGGG + Intergenic
1109631195 13:65048966-65048988 TGGCCCACAATCAGTCTGATTGG + Intergenic
1109968931 13:69739030-69739052 AGGTCTGCTATTAGTCTGATGGG - Intronic
1110251260 13:73383261-73383283 TGGCCTGCAATCAGTCTGATTGG - Intergenic
1110574027 13:77035948-77035970 TGGTCTGTGATCAGTCTGATTGG + Intergenic
1110896592 13:80760513-80760535 TCGCCTGAAATCAGTCTGACTGG - Intergenic
1110896606 13:80760675-80760697 TAGCCTGCAATCAGTCTGATTGG - Intergenic
1111055496 13:82944234-82944256 TGGCCAACAACCAGTCTGATTGG + Intergenic
1111055509 13:82944385-82944407 TGGCCCACGACCAGTCTGATTGG + Intergenic
1111164726 13:84444624-84444646 AAGCCTGCAGTTAGTCTGATAGG + Intergenic
1111332871 13:86782756-86782778 TGGCCCACAACCAGTCTTATTGG + Intergenic
1111474484 13:88726455-88726477 TGGCCTGAAACCTGTGTGATTGG - Intergenic
1111742368 13:92219781-92219803 TGGTCCACAATCAGTCTGATTGG - Intronic
1111936159 13:94558858-94558880 TGGCCTGCGACCAGCCTGATTGG - Intergenic
1111936173 13:94559019-94559041 TGGTCTGTGATCAGTCTGATTGG - Intergenic
1112448292 13:99487127-99487149 TGGCCCACAATCAGTCTGATTGG + Intergenic
1112449555 13:99496454-99496476 CAGCCCACAATCAGTCTGATTGG + Intergenic
1112449592 13:99496788-99496810 TGGCCCACAATCAGTCTGATTGG + Intergenic
1112550324 13:100414051-100414073 TGGTCTACAATCAGTCAGGTTGG - Intronic
1112552680 13:100436324-100436346 TGGCTGGCAATCAGTCTGATTGG + Intronic
1112767811 13:102763974-102763996 TGGCCCACAGTCAGTCTGATTGG - Intergenic
1112844850 13:103628656-103628678 TGTCCTGCAAGAATTCTGATTGG + Intergenic
1112921225 13:104615115-104615137 AGGCCTGCAACCAATCTGATTGG - Intergenic
1114787399 14:25616630-25616652 TGGCCCACAACCAGTCGGATTGG - Intergenic
1114990012 14:28274677-28274699 TGGCCTGGAAAAAGTCTGCTGGG - Intergenic
1115531557 14:34332843-34332865 TGGCCTGCAATCGGTCTGACTGG - Intronic
1117135915 14:52734002-52734024 TGGCTTGCAATTGGTCTGATTGG + Intronic
1117917027 14:60688500-60688522 TGGCTCGCAATCGGTCTGATTGG - Intergenic
1118450945 14:65901651-65901673 TGGCCCACGACCAGTCTGATTGG - Intergenic
1119676781 14:76561730-76561752 TGACCCGTAATCAGTCTGATTGG + Intergenic
1120286928 14:82514964-82514986 TGGCCTGCAATCAGTCTGATTGG - Intergenic
1120820517 14:88907637-88907659 TGGCCCTCGACCAGTCTGATTGG - Intergenic
1122632863 14:103115339-103115361 TGGCCTGCAATCAACCTGATTGG + Intergenic
1125114187 15:36068876-36068898 TGGCATTCAATCAGGCTGGTGGG - Intergenic
1125555707 15:40582974-40582996 TGGCCAGCAATCAGTTTGATTGG - Intergenic
1125772398 15:42178299-42178321 TGGCCAGCAATCATTTTGTTTGG - Exonic
1125817975 15:42602617-42602639 TAGCTTGCAATCTGTCTGATTGG + Intronic
1125817985 15:42602755-42602777 CGGCCAGCAATCAGCCTGATTGG + Intronic
1125818641 15:42608528-42608550 TTTCCTGCAATCAGGCTGCTAGG - Intronic
1126242715 15:46464129-46464151 TAGCCGGCAATCAGTCTGATTGG - Intergenic
1129063077 15:72876511-72876533 TGGCCTGAGACCAGTCTGATTGG - Intergenic
1129063082 15:72876592-72876614 TGGCCTGCAACCAGTCTGATTGG - Intergenic
1129386450 15:75198792-75198814 TAGCCCGCAACCAGTCTGATTGG + Intronic
1131070507 15:89462732-89462754 TGGCCTACAACCAGTCTGATTGG - Intergenic
1131071536 15:89469550-89469572 TGGCCCGCAACCAGTCTGATTGG - Intergenic
1131294130 15:91132276-91132298 TAGCCCACAATCAGTCTGATTGG + Intronic
1131294145 15:91132426-91132448 TGGCCTGCAATCAGTCTGATTGG + Intronic
1131325741 15:91442377-91442399 TGCCTGGCAATCAATCTGATTGG + Intergenic
1133099051 16:3468039-3468061 TGACCTGCGATCAGTCTGATTGG + Intronic
1133177596 16:4026994-4027016 TGGCCTGGGACCAGTCTGGTTGG - Intronic
1133177609 16:4027075-4027097 TGGCCTGTGACCAGTCTGATTGG - Intronic
1133679652 16:8109033-8109055 GGGCCAGCCACCAGTCTGATTGG + Intergenic
1134407800 16:13977425-13977447 TGGCCAGCATCCATTCTGATTGG - Intergenic
1134606538 16:15575781-15575803 TGGCCCACAATTAGTCTGATTGG + Intronic
1135123356 16:19785583-19785605 CGGCCCGCAATCAGTCTGATTGG - Intronic
1135123362 16:19785684-19785706 TAGCCAGCAATCAGTCTGATTGG - Intronic
1135408420 16:22215029-22215051 TGGCCTGGGATCAGTCTGATAGG + Intronic
1135656075 16:24250719-24250741 TGGCCTGCAATTGCTCTTATTGG + Intergenic
1137393705 16:48102171-48102193 TGGCCTGCCACCAGCCTGATTGG - Intronic
1137635968 16:49986716-49986738 TGGCCCGCAATCAGTCTGATTGG + Intergenic
1137802307 16:51272574-51272596 TGGCCTGCAACCAGTCTGATTGG + Intergenic
1137845241 16:51681297-51681319 TGGCCAGAGATAAGTCTGATTGG - Intergenic
1138643557 16:58405796-58405818 TGCCCTGCAAACAGTCTAATGGG - Intronic
1138807519 16:60108192-60108214 CCTCCTGCAATCAGTCAGATTGG - Intergenic
1138851298 16:60632965-60632987 TGGCCCACGATCAGTTTGATTGG + Intergenic
1138851308 16:60633051-60633073 AGGCCTGCAACCAGTCTGATTGG + Intergenic
1139601679 16:67991193-67991215 TGGCCAGGAAGCAGTCTGACTGG + Intronic
1140830201 16:78743796-78743818 TGGCCCACAATCAGTCAGATTGG - Intronic
1140847368 16:78903222-78903244 TGGCCTGCAATCAGTCTTATTGG + Intronic
1141978800 16:87536478-87536500 CGGCCTGCAATCGGTCTGATTGG + Intergenic
1143437560 17:6940458-6940480 TGGCCCCCGACCAGTCTGATTGG + Intronic
1144306022 17:13970301-13970323 TGGCCCTCAATCAATCTGATTGG - Intergenic
1144306439 17:13973088-13973110 TGGCCTACAATCATTCTGATTGG - Intergenic
1144480663 17:15626492-15626514 TTTTCTCCAATCAGTCTGATTGG - Intronic
1144917646 17:18737249-18737271 TTTTCTCCAATCAGTCTGATTGG + Intergenic
1145225580 17:21125416-21125438 TGGCCTGTGATCAGCCTGATTGG + Intronic
1145266480 17:21382077-21382099 TGGCCTGCCATCTGTCTGTCTGG + Intronic
1146038590 17:29430340-29430362 TAGCCTGCAATCAGTCTGATTGG + Intronic
1146276123 17:31516917-31516939 TGGCCCACAGTCAGTTTGATTGG + Intronic
1146443501 17:32917366-32917388 TGGCCTGCAATCAGTCTAATTGG - Intergenic
1146444943 17:32926252-32926274 TTGGCCGCAATCAGTCTGACTGG - Intergenic
1146444951 17:32926342-32926364 TGGCCCGCAATCAGTCTGATCGG - Intergenic
1148146391 17:45367611-45367633 TGACCTCCAAAAAGTCTGATTGG - Intergenic
1149697133 17:58624954-58624976 TGGCCTGCACACAGGCTTATAGG + Intronic
1150037642 17:61821110-61821132 TGGCCTGTGACCAGTCTGATTGG + Intronic
1150299710 17:64037912-64037934 CAGTCTGCAATCAGTCTGATTGG - Intergenic
1152995447 18:402261-402283 TGGCCTACAACCAGTCTGACTGG + Intronic
1153539296 18:6136606-6136628 TGGGCCACAGTCAGTCTGATCGG - Intronic
1153960566 18:10136500-10136522 AGGCCCGTGATCAGTCTGATTGG - Intergenic
1154294735 18:13138118-13138140 TGGCCCATAATCGGTCTGATTGG + Intergenic
1154335485 18:13461680-13461702 TGGCCTTTGATCAGTCTGATTGG + Intronic
1155450533 18:25958610-25958632 TGGCCTACAATTGGTCTGATGGG + Intergenic
1155450544 18:25958764-25958786 CTACCAGCAATCAGTCTGATTGG + Intergenic
1155797725 18:30060735-30060757 TAGCCCTCAATCAGTCTGATTGG + Intergenic
1156529804 18:37804593-37804615 AGACCTGCTATTAGTCTGATGGG + Intergenic
1156849328 18:41707970-41707992 TGGCCTGCAATCAGTCTGATTGG + Intergenic
1158344929 18:56506599-56506621 TGGCCTGCAAACAGCCTGATTGG - Intergenic
1158344938 18:56506760-56506782 TGGCCCACGATCAGTCTGATTGG - Intergenic
1158597235 18:58827119-58827141 TGGCCCACAGTCAGTCTGATTGG - Intergenic
1158634848 18:59147682-59147704 AGGGCTGAAATCAGTTTGATTGG + Intronic
1158654897 18:59321763-59321785 TGGCCTGCAATCAGTCTGATTGG - Intergenic
1159239526 18:65723880-65723902 TGGCTTGCAACCAGTCTGATTGG - Intergenic
1159266897 18:66092840-66092862 TGGCTTAGAAACAGTCTGATTGG - Intergenic
1160294082 18:77622089-77622111 TGGCCTACAATCAGTCTGATTGG + Intergenic
1162238040 19:9323743-9323765 TAGCCCGCGTTCAGTCTGATTGG - Intergenic
1164460680 19:28445015-28445037 CGGCCTGCAATCAGTCTGATGGG - Intergenic
1164460697 19:28445176-28445198 TAGCCCACAATCAATCTGATTGG - Intergenic
1164461525 19:28453062-28453084 CGGCCTGCAGTCAGTCTGATTGG - Intergenic
1164655471 19:29918002-29918024 TGGCCCGAAATCTGTCTGATTGG - Intergenic
1165111083 19:33502663-33502685 TGGCCTGCCATCAGTCTGATTGG - Intronic
1165122823 19:33573014-33573036 TGGTTTGCAACCAGTCTAATTGG + Intergenic
1165122831 19:33573095-33573117 TGGTCTGTGACCAGTCTGATTGG + Intergenic
1165255395 19:34574787-34574809 TGGCCCACAATCAGTCTGATCGG + Intergenic
1165533574 19:36424074-36424096 TGGCCCACAACCAGTCTGATTGG + Intergenic
1166260129 19:41633276-41633298 TGGCCTGCAATCAGTCTGATTGG + Intronic
1166952966 19:46442481-46442503 TCGCCTGCAATCAGTCTGATTGG - Intergenic
1167012614 19:46818849-46818871 TGGCCTGTGACCAGTCTGATTGG + Intergenic
1167012621 19:46818903-46818925 AGGCCTGTAACCAGTCTGATTGG + Intergenic
1167012629 19:46818957-46818979 AGGCCCGCAGCCAGTCTGATTGG + Intergenic
1167399714 19:49256781-49256803 TGGCTGGCATTCATTCTGATTGG - Intergenic
925372505 2:3357066-3357088 TGGCCCACAATCAGTGTGATTGG - Intronic
926042612 2:9686203-9686225 TGGCCCACAACCAGTCTGATTGG + Intergenic
926212259 2:10879711-10879733 GGCCCGGCAATCAGTCTGACTGG - Intergenic
928804871 2:35138960-35138982 AGGCCTGCTGTTAGTCTGATGGG + Intergenic
929443260 2:41982751-41982773 TGGCCTGCAGTCACTTTAATGGG - Intergenic
929711509 2:44271486-44271508 CCGCCCGCAATCAGTCTGATTGG + Intergenic
929711519 2:44271571-44271593 CAACCCGCAATCAGTCTGATTGG + Intergenic
930653058 2:53981434-53981456 TGGCCCACAATCAGTCTGATTGG + Intronic
930653066 2:53981525-53981547 TGGCTTGCAATCAGTCTGACTGG + Intronic
932013662 2:68002265-68002287 AGGTCTGCTATTAGTCTGATGGG - Intergenic
932692481 2:73925162-73925184 TGGCCAGCGATCAGTCTGATTGG + Intergenic
933660672 2:84925034-84925056 TGGCCCACTATCAGTCTGATTGG - Intergenic
934899723 2:98149491-98149513 TGGCCTGCAGTCAGTCTGATTGG + Intronic
935309259 2:101767033-101767055 TGGCCTGCAGTCAGTCTTATTGG + Intronic
936110445 2:109660265-109660287 TGGCCTACAATCAGCCTGATTGG - Intergenic
936801120 2:116268062-116268084 TGGCCCATGATCAGTCTGATTGG - Intergenic
937469662 2:122164377-122164399 TGGCTTGAAATCAGGCTGAAAGG + Intergenic
938802932 2:134779362-134779384 TGGCTCACAATCAGTCTGATTGG + Intergenic
939998868 2:148947559-148947581 TGGCCTGTAATCAGCCTCAGCGG + Intronic
940376267 2:152962594-152962616 TGGCCTGTGACCAGTCTGATTGG + Intergenic
940377463 2:152971871-152971893 TGGCTTGTGGTCAGTCTGATTGG + Intergenic
941250995 2:163162226-163162248 TGTTCTGCAATCAGTCTGATTGG + Intergenic
941816357 2:169799399-169799421 TGGCCTCCAGTCAGTCCCATAGG - Exonic
941990701 2:171554078-171554100 TGGCCTGCAGTCAGTTTGATTGG + Intronic
942021982 2:171875159-171875181 TGGCCCGCAATTGGTCTGATTGG - Intronic
943066443 2:183091524-183091546 TATCCTGCAGTCAGTCTGATTGG + Intronic
943066457 2:183091687-183091709 TGGCCTGCAATTAGTCTGATTGG + Intronic
943455615 2:188103327-188103349 ATGCCTGCAAACACTCTGATGGG - Intergenic
943805315 2:192117725-192117747 TGGCCTGGGACCAGTCTGATTGG - Intronic
943847437 2:192669808-192669830 TAGCTCGCAATCAGTTTGATTGG + Intergenic
943847448 2:192669971-192669993 CGGCCTATAATCAGTCTGATTGG + Intergenic
944328813 2:198440858-198440880 TGGCCTGCAACCAGTCTGATTGG + Intronic
945063814 2:205931517-205931539 TGGCCTATGATCAGTCTGATTGG + Intergenic
945314614 2:208359069-208359091 TGGCCTGCAATCAGTGTGATTGG + Intergenic
945439556 2:209863196-209863218 AGGCCTGCTGTTAGTCTGATGGG + Intronic
946101660 2:217330426-217330448 TAGCCGGCAATCACTCTGATTGG + Intronic
946119639 2:217498573-217498595 CCACCTGCAATCAGTCTGACTGG - Intronic
946119654 2:217498738-217498760 TAGCCAGCGATCAGTCTGTTTGG - Intronic
946596683 2:221313300-221313322 TGGACTCCACTCAGTCTTATAGG - Intergenic
947216134 2:227751875-227751897 TAGCCAACAATCAGTCTGATTGG + Intergenic
947472763 2:230413569-230413591 CGGCCTGCAATCAGTCTGATTGG + Intergenic
947472776 2:230413732-230413754 TGGCCTGCAATCAGTCTGATTGG + Intergenic
947539948 2:230969510-230969532 TGGCCCGAAATCAATCTGATTGG - Intergenic
947719491 2:232361653-232361675 GGACCTTCAATCAATCTGATTGG - Intergenic
947719499 2:232361734-232361756 TGGCCAGCAATCAGTCTGATTGG - Intergenic
947719510 2:232361872-232361894 TGGCCTGCAATCAGTCTGATTGG - Intergenic
947872741 2:233448697-233448719 TAGCTTGCATTCAGTCTGATTGG + Intronic
947882619 2:233532240-233532262 TAGCTGGCAATCAGTCTGATTGG - Intronic
947882632 2:233532403-233532425 GAGCCCGCCATCAGTCTGATTGG - Intronic
948023060 2:234753111-234753133 TGACCCACAATCAGTCTGATTGG + Intergenic
948075460 2:235162269-235162291 AGGCCCACAACCAGTCTGATTGG + Intergenic
948154897 2:235773342-235773364 TGGCCTACGGTCAGTCTGATTGG + Intronic
948289071 2:236811185-236811207 TGGCCCGCAATCAGTCTGATTGG - Intergenic
1169685625 20:8267897-8267919 TGGCCCACAACCAGTCTGATTGG + Intronic
1169698942 20:8425000-8425022 TAGCCTGCAATCGGTCTGATTGG + Intronic
1170018767 20:11812842-11812864 GGACCGGCCATCAGTCTGATTGG + Intergenic
1172732145 20:37096903-37096925 TCTCCCGCCATCAGTCTGATTGG - Intergenic
1172732154 20:37096994-37097016 TAGCCCACAATCAGTCTGAGTGG - Intergenic
1174532628 20:51226108-51226130 TGCCCCACCATCAGTCTGATTGG + Intergenic
1174596653 20:51689437-51689459 TGGCCTGCAAACAGCCTGATTGG - Intronic
1174953157 20:55065803-55065825 AGGTCTGCTGTCAGTCTGATGGG + Intergenic
1175311588 20:58015466-58015488 TGGCCTGCAATCAGCCATAGTGG - Intergenic
1175602589 20:60287084-60287106 TGGCCTGTGACCAGTCTGATTGG - Intergenic
1175635848 20:60582357-60582379 TGGCCTTCAATCAGTCATGTTGG + Intergenic
1175989735 20:62782346-62782368 GTGACTGCAACCAGTCTGATTGG - Intergenic
1177405530 21:20662789-20662811 TGGCCTGGAATCAATCTGTGAGG + Intergenic
1177897131 21:26866777-26866799 TGGCCCCCGACCAGTCTGATTGG - Intergenic
1178401860 21:32293287-32293309 TAGCCTGTAATGAGTCTTATGGG - Intronic
1178975757 21:37220010-37220032 TGGACCATAATCAGTCTGATTGG - Intergenic
1179012415 21:37566090-37566112 TAGCCTGCAATCAGTCTGTCTGG + Intergenic
1179414731 21:41188954-41188976 TGGCCTCCAATCAGTCTTCTGGG - Intronic
1179969946 21:44830306-44830328 TGGCCTGCAAACATTCTGATTGG + Intergenic
1179969958 21:44830468-44830490 TGGCCTGCAATCAGTCTGATTGG + Intergenic
1180789638 22:18568126-18568148 TCTCCTGCATTCAGTCTGTTAGG + Intergenic
1180932674 22:19603993-19604015 TAGCCCACAATCATTCTGATTGG - Intergenic
1181232104 22:21427186-21427208 TCTCCTGCATTCAGTCTGTTAGG - Intronic
1181246547 22:21507674-21507696 TCTCCTGCATTCAGTCTGTTAGG + Intergenic
1182195111 22:28507686-28507708 AGGTCTGCTATTAGTCTGATAGG - Intronic
1182649740 22:31841617-31841639 TGGCTCGCAATCAGTCTGATTGG + Intronic
1184359408 22:44005740-44005762 TGGCCTGCGACCAGTCTGATTGG - Intronic
1184475932 22:44721347-44721369 TGGCCCGCAATCAGTGTGATTGG + Intronic
1184819333 22:46897333-46897355 TGGCCCGCTATCAGTCTGATTGG + Intronic
1184958920 22:47914645-47914667 GGCCCCACAATCAGTCTGATTGG + Intergenic
1185107785 22:48884095-48884117 TGGCCTGCAACTAGTCTGATTGG - Intergenic
951188419 3:19741163-19741185 TGTCCTGCAATCAGTCTGATTGG - Intergenic
951741870 3:25933268-25933290 AGATCTGCTATCAGTCTGATTGG - Intergenic
951834217 3:26963289-26963311 TAGCCTGAAATCAGTCTGATTGG - Intergenic
951859762 3:27238961-27238983 TGGCCCACAACTAGTCTGATTGG + Intronic
951897491 3:27624029-27624051 TGGCCAGTATTCATTCTGATTGG + Intergenic
952958351 3:38574603-38574625 TGGCCTCCCATCACCCTGATTGG + Intronic
953645717 3:44752192-44752214 TGGCCTATGACCAGTCTGATTGG - Exonic
953760545 3:45683466-45683488 TGGCCTAAGACCAGTCTGATTGG - Exonic
955090324 3:55744067-55744089 GGGCTGGCAATCAGTCTGATTGG - Intronic
955579528 3:60404044-60404066 TGGCCCACAATCAGTCTGATTGG - Intronic
955904764 3:63795062-63795084 CTGCCCGCAATCAGTCTGATTGG - Intergenic
955904779 3:63795225-63795247 TAGCCCTCAATCAGTCTGATTGG - Intergenic
956734966 3:72231400-72231422 TGCCCTGCAATCCCCCTGATGGG - Intergenic
957924616 3:86792327-86792349 TGACCTGCAATGATTCTGAATGG - Intergenic
957952929 3:87148133-87148155 TGGCCTGCAATCAGTCTGATGGG - Intergenic
958434826 3:94083465-94083487 TGGCCCGCAATCAGTCTGATTGG + Intronic
958483851 3:94678134-94678156 AGGCCTGCTGTTAGTCTGATGGG - Intergenic
958845287 3:99258734-99258756 AGGCCTGCAACCAAACTGATTGG + Intergenic
959464980 3:106674703-106674725 TGGCCTGCAATCAGTCTGATTGG - Intergenic
959596678 3:108136577-108136599 TGGCCTGTGATCAGTCTGATTGG + Intergenic
960037863 3:113119637-113119659 TGCCCTCAAATCAGACTGATGGG - Intergenic
960367445 3:116790060-116790082 AGGTCTGCAAACACTCTGATTGG + Intronic
960872420 3:122263203-122263225 TGTCATGCAATCTCTCTGATAGG - Intronic
960899510 3:122540780-122540802 TCTCCTGCCATCAATCTGATGGG - Exonic
961863507 3:129937028-129937050 TCAGCTGCAATCAGTCTGATTGG + Intergenic
963230802 3:142907207-142907229 TGACCCGCAATCAGTCTGATTGG + Intergenic
963914111 3:150841783-150841805 TGGCCTGCAATGAGTCTGATCGG - Intergenic
964528183 3:157638072-157638094 TGGCCTGCATTATTTCTGATGGG - Intronic
964627798 3:158776127-158776149 TGGTCCGCAATCAGTCTGATTGG + Intronic
964749607 3:160042251-160042273 TGGCCCACAACCAGTCTAATTGG + Intergenic
964974534 3:162603069-162603091 AGGTCTGCTATAAGTCTGATGGG - Intergenic
965090139 3:164151071-164151093 TGGCCTGCCAGCACTTTGATGGG - Intergenic
966379015 3:179324698-179324720 TGGCCTGGATTCAGGCTGTTAGG - Intronic
967268525 3:187713695-187713717 AGGCCTACAATCAGTCTGATTGG + Intronic
969505269 4:7582836-7582858 TAACCTGCAAGCAGCCTGATTGG + Intronic
970228437 4:13883790-13883812 TGGCCTGTGATCAGTCTGATTGG + Intergenic
972746094 4:41934296-41934318 TGGCCCGCAATCAGTCTGAATGG - Intergenic
972769064 4:42179330-42179352 TGGCTTGCAATCAGTCTGACTGG + Intergenic
972769075 4:42179493-42179515 TGGCCTGCAATCAGTCTGATTGG + Intergenic
973908421 4:55553602-55553624 TGGCTTGCAATTGGTCTGAGTGG + Intergenic
974532214 4:63123606-63123628 TAGCCGGCAATCAGTCTGATTGG - Intergenic
974768844 4:66384321-66384343 AGGTCTGCTATTAGTCTGATGGG - Intergenic
975442926 4:74433727-74433749 TGGCCTGTGACCAGTCTGATCGG + Intergenic
975443867 4:74440518-74440540 TGACCTGCGATCAATCTGATTGG + Intergenic
975639907 4:76490074-76490096 TAGCATGCAATCAGTCTGATTGG + Intronic
975639919 4:76490234-76490256 TAGCCGGCAATCAGTCTGACTGG + Intronic
975756719 4:77578600-77578622 TGGCCTGGAATCAATCTGTGAGG + Intronic
978034798 4:103978837-103978859 TGGCCTGCCACCAGTCTGATTGG - Intergenic
978034805 4:103978918-103978940 TAGCTTGCAACCAGTCTGATTGG - Intergenic
978115571 4:105016354-105016376 AGGTCTGCCATTAGTCTGATGGG - Intergenic
978396387 4:108285073-108285095 TGGACTGTTATCAGTCTGATTGG + Intergenic
979424160 4:120544844-120544866 TAGCCCACAATCAGTCTGATTGG + Intergenic
979424171 4:120544988-120545010 TGACCTGCTATCAGTCTGATTGG + Intergenic
980113272 4:128654935-128654957 TGGCCCAAGATCAGTCTGATTGG + Intergenic
980407402 4:132371068-132371090 TAGCCCGCAATCAGTCTGATTGG - Intergenic
981346394 4:143682410-143682432 TAGCCCGCAATCAGTCTGATTGG - Intronic
981456884 4:144962734-144962756 TGGCCTGGAATCAATCTGTGAGG + Intergenic
982373380 4:154658756-154658778 CGGCAGGCAACCAGTCTGATTGG - Intronic
982373392 4:154658919-154658941 TAGCTAGCAGTCAGTCTGATTGG - Intronic
982963730 4:161875464-161875486 TAGTCTGCCATCAGTCTGATTGG - Intronic
985690806 5:1311245-1311267 TGGCCCACGACCAGTCTGATTGG + Intergenic
986254294 5:6088848-6088870 TGGCCCACAACCAGCCTGATTGG - Intergenic
986808973 5:11335829-11335851 TGGCCCACAATCAGTCTGATTGG - Intronic
986850437 5:11805969-11805991 TCTCCTGGAATCTGTCTGATAGG - Intronic
987137617 5:14914357-14914379 TGGCCGGCAGTCAGTCTGATTGG - Intergenic
988297372 5:29382991-29383013 TAGCCCACACTCAGTCTGATTGG - Intergenic
989002473 5:36775443-36775465 AGGCCTGCAACCAGTCTGATTGG - Intergenic
989158644 5:38369012-38369034 TGGCCTGCAGACAGTGTGAATGG - Intronic
990688277 5:58333145-58333167 TAGCCTGCAAGCAGTCTGATTGG + Intergenic
990841233 5:60081805-60081827 AGGTCTGCCATTAGTCTGATGGG + Intronic
991913783 5:71586760-71586782 GGACCCCCAATCAGTCTGATTGG + Intergenic
992068563 5:73129290-73129312 TGGCCCACAATCCGTCTGATTGG + Intronic
992171145 5:74103326-74103348 TGGCCCACAACCAGTCTAATGGG - Intergenic
992435947 5:76756280-76756302 TAGCCCACAATCAGTCTGATTGG + Intergenic
992571887 5:78066943-78066965 AGGTCTGCTGTCAGTCTGATGGG - Intronic
993311764 5:86341251-86341273 TGGTCTGCTGTTAGTCTGATGGG + Intergenic
994188663 5:96843281-96843303 GTACCTGCAATCAGTCTGATTGG + Intronic
994346632 5:98695478-98695500 TGGTCTGCTGTTAGTCTGATGGG + Intergenic
995298102 5:110542865-110542887 TGGCCCACGATCAGTCTGATTGG - Intronic
995598409 5:113771633-113771655 TAGCCTGCAATCAGTCTGATTGG + Intergenic
995598423 5:113771796-113771818 CGGCCCACAATCAGTCTGATTGG + Intergenic
995599202 5:113777397-113777419 CAGCCTGCAATCAGTCTGATTGG + Intergenic
996109597 5:119549723-119549745 GGGCCTGCAGTCAGTCTGATTGG - Intronic
996207231 5:120756013-120756035 TGACCTGCAACTAGTCTGATTGG + Intergenic
996243605 5:121232605-121232627 TGGCCCACGAGCAGTCTGATTGG + Intergenic
996253608 5:121370016-121370038 TGGCGTTCAATCAGGCTGGTGGG - Intergenic
998472844 5:142396805-142396827 TGGCCAGGGACCAGTCTGATTGG + Intergenic
999081204 5:148845087-148845109 AGGCATCCAATCAGGCTGATGGG - Intergenic
999398347 5:151245263-151245285 TGGCCCACAATCAGTCTGATCGG + Intronic
999399172 5:151251271-151251293 TGGCCCGCAATCAGTCTGACTGG + Intronic
999526722 5:152414388-152414410 TGGCCTACAATCATTCTGACTGG - Intronic
999853163 5:155564779-155564801 AGGCCTGCAACCAGTCCGGTTGG - Intergenic
1000213006 5:159126694-159126716 TGGCCTCCATTCTTTCTGATAGG + Intergenic
1000383206 5:160647511-160647533 TGTCCTGAAATCCGTCTGAGAGG + Intronic
1000556456 5:162732435-162732457 TGGTCTGGAATCAGTCTGTGAGG - Intergenic
1000959594 5:167584356-167584378 TGGCCAACAACCAGTCTGATTGG + Intronic
1001031072 5:168263333-168263355 TGTCCTACAAGCAGTCTGAGTGG - Intronic
1003226265 6:4208607-4208629 AGGCCTGCAATAAGTATGACTGG + Intergenic
1003348081 6:5289625-5289647 TGGCCTGTGACCAGTCTGATTGG + Intronic
1003351134 6:5318785-5318807 AGGTCCGCAACCAGTCTGATTGG + Intronic
1004245417 6:13971061-13971083 TAGCCTGCACTAAGTCTGCTTGG + Intronic
1004706224 6:18126248-18126270 TGGCCCGCAATCAGTCTGATTGG + Intergenic
1004760295 6:18658175-18658197 AGGTCTGCTGTCAGTCTGATGGG - Intergenic
1007106603 6:39287519-39287541 TGGTCTGCATTCAGTCAGAAAGG - Intergenic
1007602831 6:43094023-43094045 GGGCCAGCAGTCAGTCTGATTGG + Intronic
1008081615 6:47200675-47200697 TGTCATGCAATCAGTCAAATGGG - Intergenic
1008630721 6:53360789-53360811 TAGCCCGCAATCAGTCTGATTGG + Intergenic
1008959189 6:57248620-57248642 TGGCCCACTACCAGTCTGATTGG + Intergenic
1010972949 6:82282730-82282752 TGGTCTGCTCTTAGTCTGATGGG + Intergenic
1011067374 6:83341951-83341973 TGGCCCACAGTCAGTGTGATTGG - Intronic
1011067388 6:83342113-83342135 TGGCCTGCAATCAGTCTGATTGG - Intronic
1011606400 6:89110504-89110526 TGGCCTGGGACCAGTCTGATTGG + Intronic
1012324153 6:97893793-97893815 TGTCCTGCTATTAGGCTGATAGG + Intergenic
1012711607 6:102613863-102613885 TGGCCTGCAACCAGTCTAATTGG - Intergenic
1012713467 6:102637931-102637953 TGGCCTGTGACCAGTCTGATTGG - Intergenic
1012713473 6:102638016-102638038 TGGCCCACAACAAGTCTGATTGG - Intergenic
1013534692 6:111053172-111053194 AGGCCTGCAATCAGTCTGAATGG + Intergenic
1014547874 6:122753850-122753872 TAGCTGGCAATCAGTCTGATTGG + Intergenic
1015105697 6:129533451-129533473 TGGCCTATGACCAGTCTGATTGG - Intergenic
1015105704 6:129533532-129533554 TGGCCTGCAACCAGTCTAATAGG - Intergenic
1015161647 6:130159013-130159035 AGGCCTGCTACCAGTCTGACTGG + Intronic
1015484932 6:133758727-133758749 TGGGCTGCTATAAGTCTAATAGG - Intergenic
1015518435 6:134107951-134107973 TGCCCTGTGATCAGTCTGTTTGG - Intergenic
1015547783 6:134379148-134379170 TGGCCCACAACCAGTCTGATTGG + Intergenic
1015855839 6:137623514-137623536 TGGACTGCAATTAGTCTGAATGG - Intergenic
1017032973 6:150240518-150240540 TGGCCTGCAACCAGTCTGATTGG + Intronic
1018277215 6:162145896-162145918 TGGCCTGTAATCAGTCTGACTGG + Intronic
1018326994 6:162681595-162681617 TGGCCCACAATCATTTTGATTGG - Intronic
1020660206 7:10973228-10973250 TAACGCGCAATCAGTCTGATTGG - Intergenic
1021173905 7:17427986-17428008 TGGCCAACAACCAGTCTGATTGG - Intergenic
1021226860 7:18037831-18037853 TGGCCTGCGACCAGTCTGATTGG - Intergenic
1021500496 7:21328130-21328152 TGGTCTGCAATCAATCTGATTGG + Intergenic
1023311165 7:38887807-38887829 AGACCTGCTGTCAGTCTGATAGG - Intronic
1023480365 7:40627384-40627406 TGGCCCACAATCAGTCTGATTGG + Intronic
1023480378 7:40627547-40627569 TGGCCCACAATCAGTCTGATTGG + Intronic
1023742516 7:43293397-43293419 TAGCCCACAATCAGTCTGATTGG + Intronic
1023817303 7:43961059-43961081 GTGCCCACAATCAGTCTGATTGG + Intergenic
1024630356 7:51242212-51242234 TGGCCCACAGTCAGTCTGATTGG - Intronic
1026184744 7:68073880-68073902 TGCCCTGCAATCAGTCCGGTTGG + Intergenic
1026253246 7:68689205-68689227 TGGCTGCCCATCAGTCTGATTGG + Intergenic
1026253254 7:68689296-68689318 TGGCCCACGATCAGCCTGATTGG + Intergenic
1026353855 7:69540451-69540473 TGGCTGGCAATCAGTCTGATTGG + Intergenic
1027004961 7:74685067-74685089 TGGCCTGCAAGCAGTCTGATTGG + Intronic
1027749512 7:82124468-82124490 TGGCCTGCAGTCAGTCTGATTGG - Intronic
1028034018 7:85956537-85956559 TGGAATGAAATCAGTCTGGTTGG - Intergenic
1028343246 7:89748193-89748215 TGTCCTTCTATCAGTCTGACTGG - Intergenic
1029676428 7:102072464-102072486 GGCCCTGCAATCAGTCTGGTTGG + Intronic
1030041351 7:105453162-105453184 TGGCCTGGAATCAATCTGTGAGG + Intronic
1030112139 7:106035839-106035861 CGGCTGGCAATCAGTCTGATTGG + Intergenic
1030115983 7:106062668-106062690 TGGCCTGCAATCAGTCTGATTGG + Intergenic
1030973414 7:116090253-116090275 TGGCCCGCAATCAGTCTAATTGG - Intronic
1031051680 7:116951634-116951656 GGACCCGCAGTCAGTCTGATTGG - Intergenic
1031051700 7:116951874-116951896 TAGCCCGCAATCAGTCTGACTGG - Intergenic
1031298324 7:120033422-120033444 TGTCTTGTGATCAGTCTGATTGG - Intergenic
1032251617 7:130262422-130262444 TGGCCTGAAATCAATCTGTGAGG + Intergenic
1032252672 7:130271488-130271510 TAGCCTGCGATCAGTGTGATTGG + Intronic
1032252680 7:130271579-130271601 TGGCTTGCAACCAATCTGATTGG + Intronic
1032457532 7:132084829-132084851 CCGCCTGCAATCAGTCTGATTGG - Intergenic
1032457543 7:132084968-132084990 TGGCCTGCAATCGGTCTGATTGG - Intergenic
1032700971 7:134378754-134378776 CGGCCCGCAATCAGTCTGATTGG + Intergenic
1032700983 7:134378912-134378934 TGCCTCTCAATCAGTCTGATTGG + Intergenic
1032870641 7:135980854-135980876 TGGCCCGCAATCAGTCTGATTGG + Intergenic
1033798755 7:144876915-144876937 TGGCCTGCAACAAGTCTGTTGGG + Intergenic
1034248358 7:149666560-149666582 TGGCTGGCATTCATTCTGATTGG + Intergenic
1036462914 8:8969994-8970016 TGGCTCACAATCAGTGTGATTGG + Intergenic
1036732777 8:11280974-11280996 TGGCCTGCAACCAGTCTGAATGG + Intergenic
1037137177 8:15476990-15477012 TGGATTGCAATCAATGTGATTGG + Intronic
1037532535 8:19791547-19791569 TGGCCCTTGATCAGTCTGATTGG - Intergenic
1037682738 8:21110956-21110978 TTGGCCCCAATCAGTCTGATTGG - Intergenic
1037682743 8:21111046-21111068 TAGACTGCAGTCAGTTTGATTGG - Intergenic
1038142680 8:24863853-24863875 TGGCCTGTGACCAGTCTGATTGG + Intergenic
1038840138 8:31177164-31177186 TGGCCTGCGATCCGTCTGATTGG - Intergenic
1039297121 8:36168847-36168869 TGGCCCACAATCAGTCTGATTGG - Intergenic
1039383729 8:37111394-37111416 TGGCCCACAACCACTCTGATTGG + Intergenic
1040555314 8:48472881-48472903 TGGCCTGCAATCGGTCTGATTGG - Intergenic
1040634974 8:49262543-49262565 TGGCCCATGATCAGTCTGATTGG - Intergenic
1042442308 8:68842729-68842751 TGGCCTGGAATCAATCTGTGAGG - Intergenic
1042630136 8:70807044-70807066 AGGTCTGCTATTAGTCTGATGGG - Intergenic
1042844155 8:73153823-73153845 TGGCCTGTGACCAGCCTGATTGG + Intergenic
1042999277 8:74737251-74737273 TAGCCCACAATCAGTCTGATTGG - Intronic
1043592094 8:81844081-81844103 AGGCCCTCAACCAGTCTGATTGG - Intergenic
1043593386 8:81855894-81855916 TGGCCTATGACCAGTCTGATTGG + Intergenic
1043820638 8:84859203-84859225 TGGCCCACAATCAGTCCGATTGG + Intronic
1044113467 8:88304575-88304597 AGGCCTGCTGTTAGTCTGATGGG - Intronic
1044413511 8:91910662-91910684 TGACCTGCAACCAGTCTGATTGG + Intergenic
1044450805 8:92334238-92334260 TGGTCTGCTCTTAGTCTGATGGG + Intergenic
1044855533 8:96471357-96471379 TGGCCAGCGACCAGTCTGATTGG - Intergenic
1044884096 8:96758257-96758279 TGAGCAGCAATCAGTCTTATGGG - Intronic
1045236366 8:100356112-100356134 TGGCCCACATTAAGTCTGATTGG - Intronic
1045406159 8:101868693-101868715 TGGCCTGTGATCAGTCTGGTTGG - Intronic
1045429102 8:102096652-102096674 TGGCCCGCCGTCAGTCTAATTGG - Intronic
1045779269 8:105845020-105845042 AGACCTGCTATTAGTCTGATGGG + Intergenic
1046304077 8:112339162-112339184 CGGCCTGCAATCAGTCTGATTGG - Intronic
1046382521 8:113470434-113470456 TGGCCACCAATCAGTCAGACAGG - Intergenic
1046412177 8:113859806-113859828 AGGTCTGCGACCAGTCTGATTGG - Intergenic
1047485697 8:125328969-125328991 TGGTCTGCAGACTGTCTGATGGG - Intronic
1047539449 8:125750304-125750326 AGGCCTGTAACCAGTCTGATTGG - Intergenic
1047682850 8:127272658-127272680 TGGCCCGCAGCCAGCCTGATTGG - Intergenic
1047682867 8:127272819-127272841 TGGCCCATAATCAGTCTGATTGG - Intergenic
1048429123 8:134352601-134352623 TGGTCTGCTATTAGTCTGATGGG + Intergenic
1049079875 8:140434058-140434080 TAGCCTGCAGTTAGTCTGATTGG - Intronic
1049248121 8:141573547-141573569 AGCCCTGCAATCAGTCTGATTGG - Intergenic
1049248128 8:141573601-141573623 TGGCTCACAACCAGTCTGATTGG - Intergenic
1049277132 8:141725482-141725504 TGGCCTGGACTCACTCTGCTGGG + Intergenic
1051231647 9:14961480-14961502 TGGCCTGCCGTCAGTCTGATTGG - Intergenic
1051231659 9:14961643-14961665 TGGCCCGCAGTCAGTCTGATTGG - Intergenic
1053114306 9:35488647-35488669 TAGCCTGCAATCAGTCTGATTGG + Intergenic
1053114318 9:35488809-35488831 TCGGCTGCAGTCAGTCTAATTGG + Intergenic
1053358899 9:37468936-37468958 TGGCCCACCATCAGTCTGATTGG - Intergenic
1053754478 9:41290711-41290733 TGGACTGCAAACAGTATGAGTGG - Intergenic
1054259996 9:62855046-62855068 TGGACTGCAAACAGTATGAGTGG - Intergenic
1054331775 9:63764962-63764984 TGGACTGCAAGCAGTATGAGTGG + Intergenic
1055013057 9:71588065-71588087 TGGCCTGCTATCTGTCTCACGGG - Intergenic
1055168428 9:73224885-73224907 AGGTCTGCTATTAGTCTGATGGG - Intergenic
1055668511 9:78576055-78576077 TGGCCTGCAATCAGTCTGATTGG - Intergenic
1055690185 9:78821814-78821836 CCACCGGCAATCAGTCTGATAGG + Intergenic
1055725964 9:79229069-79229091 AGGCCTGCCACCAGTCTGATTGG - Intergenic
1055725975 9:79229154-79229176 TAGCCTGTGACCAGTCTGATTGG - Intergenic
1056447204 9:86677539-86677561 TGGCCGGCAATCAGTCTGGTTGG - Intergenic
1056570363 9:87809459-87809481 TGGCCTGCAACCAGTCTGATTGG - Intergenic
1057340371 9:94195945-94195967 AAGCCTGCAGTTAGTCTGATAGG + Intergenic
1057926716 9:99158935-99158957 TAGCCCTCAATCAGTCTGATTGG - Intergenic
1058310545 9:103496399-103496421 TGGCCTGCGACCAGTCTGATTGG + Intergenic
1058310554 9:103496439-103496461 AGGCCCACAACCAGTCTGATTGG + Intergenic
1058530172 9:105898779-105898801 AGGCCTGCTGTTAGTCTGATGGG + Intergenic
1058760116 9:108122432-108122454 TGGCCTGCAATCAGTCTGATTGG - Intergenic
1061454867 9:130690201-130690223 TGGCCCGTGATCAGTCTGATTGG - Intergenic
1062706499 9:137947129-137947151 GGGCCTGCTACCAGTCTGATTGG + Intronic
1202799153 9_KI270719v1_random:158091-158113 TGGACTGCAAGCAGTATGAGTGG + Intergenic
1203720843 Un_GL000216v2:12244-12266 TGGAATGCAATCAATCTGAGTGG - Intergenic
1185790854 X:2927836-2927858 TGGCCCGCGATCAGTCTGATTGG - Intronic
1186818226 X:13258949-13258971 AGTCCTGCGACCAGTCTGATTGG - Intergenic
1187161840 X:16772620-16772642 CGGCCTGCAATCAGTCTGTTTGG + Intergenic
1187335318 X:18376451-18376473 TGGCCTGCAATCAGTCTGATTGG - Intergenic
1187479358 X:19640887-19640909 TGGCCCACAGTCAGTCTGATTGG - Intronic
1187789297 X:22931900-22931922 TGGCCATCAATCTGTCTGCTCGG + Intergenic
1188282676 X:28289569-28289591 TGGCCCGCAATCAGTCTGATTGG + Intergenic
1188680851 X:33002464-33002486 TGGCCTGCAATTGGTCTGATTGG + Intronic
1188680864 X:33002623-33002645 GGGCCCGCAATCAGTCTGATTGG + Intronic
1189069524 X:37848841-37848863 TGGCCCATAATCAGTTTGATTGG + Intronic
1189433378 X:40969454-40969476 TGGCCCACAATCAGTCTGATTGG + Intergenic
1189440733 X:41033374-41033396 TGGCCTGCCATCAGTCTGATTGG + Intergenic
1189652147 X:43202163-43202185 AGGTCTGCTATTAGTCTGATGGG + Intergenic
1189822371 X:44882841-44882863 TGTCCTGCAGTCAGTCTGTTGGG + Intronic
1190408892 X:50114996-50115018 TGGCCCATGATCAGTCTGATTGG - Intergenic
1190766413 X:53479399-53479421 TGGCCCACGATCAGTCTGATTGG + Intergenic
1190766433 X:53479559-53479581 AGGCCCACAACCAGTCTGATTGG + Intergenic
1190957646 X:55211073-55211095 CTGCCCGCAATCAGTATGATTGG - Intronic
1190957657 X:55211210-55211232 TAGCCCACAATCAGTCTGATTGG - Intronic
1192479411 X:71471832-71471854 TGGCCCACAATCAGTCTGATTGG + Intronic
1192565959 X:72163810-72163832 TGGCCCACAGTCAGTCTGATTGG - Intergenic
1192566577 X:72169164-72169186 TGGCCCACAATCAGTCTGATTGG + Intergenic
1193148538 X:78102247-78102269 TGGCCTGCCACCAGCCTGATTGG - Intronic
1193748146 X:85309167-85309189 TGGCCCGTTATCAGTCGGATTGG - Intronic
1193947511 X:87756184-87756206 TGACCTGTAACCAGTCTGATTGG + Intergenic
1194474492 X:94341909-94341931 TAGCCCACAATCAGTCTGATTGG - Intergenic
1194491211 X:94551978-94552000 AGGCCTACAACCGGTCTGATTGG - Intergenic
1195652117 X:107295774-107295796 TGGCTGGCTATCAGTCTGACTGG - Intergenic
1195652132 X:107296097-107296119 TGGCCTGCAATCAGTCCGATTGG - Intergenic
1196265186 X:113635287-113635309 TGTCCTGCAATCAGTCTTTCAGG - Intergenic
1196392118 X:115218581-115218603 TGGCGTGCAATCAGTCTGATTGG - Intronic
1196392122 X:115218672-115218694 TGGCCTGCAATCAATCTGATTGG - Intronic
1196759364 X:119187553-119187575 TGGCCCACAATCAGTCTGATTGG - Intergenic
1196844265 X:119886086-119886108 TGGCCCCCAATCCGTATGATTGG - Intergenic
1196858493 X:120005762-120005784 TAGCCTGCAATCATTCTGATTGG + Intergenic
1196858501 X:120005890-120005912 TGGCCCACAATCAGTTTGATTGG + Intergenic
1196872787 X:120128471-120128493 TGGCCTGCAATCAGTCTGAATGG + Intergenic
1197482656 X:127006128-127006150 AGGCCTGCTGTTAGTCTGATGGG - Intergenic
1197716995 X:129716717-129716739 TGACCCGCAATCAGTCTGATTGG + Intergenic
1198102525 X:133434407-133434429 TGGCCTGCAATCATTCTGATTGG + Intergenic
1198102534 X:133434570-133434592 TGGCCTGCAATCAGTGTGATTGG + Intergenic
1199113717 X:143964656-143964678 TTGCTTGTGATCAGTCTGATTGG + Intergenic
1202082175 Y:21094582-21094604 TGGTCTGCTGTTAGTCTGATTGG - Intergenic