ID: 959464983

View in Genome Browser
Species Human (GRCh38)
Location 3:106674723-106674745
Sequence ACCCAATGCAAATGAAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959464983_959464987 12 Left 959464983 3:106674723-106674745 CCATTACTTCATTTGCATTGGGT No data
Right 959464987 3:106674758-106674780 GCCAATGGAAAACCTCTAGAGGG No data
959464983_959464985 -3 Left 959464983 3:106674723-106674745 CCATTACTTCATTTGCATTGGGT No data
Right 959464985 3:106674743-106674765 GGTGTACAACAAGTGGCCAATGG No data
959464983_959464986 11 Left 959464983 3:106674723-106674745 CCATTACTTCATTTGCATTGGGT No data
Right 959464986 3:106674757-106674779 GGCCAATGGAAAACCTCTAGAGG No data
959464983_959464984 -10 Left 959464983 3:106674723-106674745 CCATTACTTCATTTGCATTGGGT No data
Right 959464984 3:106674736-106674758 TGCATTGGGTGTACAACAAGTGG No data
959464983_959464989 19 Left 959464983 3:106674723-106674745 CCATTACTTCATTTGCATTGGGT No data
Right 959464989 3:106674765-106674787 GAAAACCTCTAGAGGGTATTTGG 0: 5
1: 9
2: 51
3: 71
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959464983 Original CRISPR ACCCAATGCAAATGAAGTAA TGG (reversed) Intergenic
No off target data available for this crispr