ID: 959464984

View in Genome Browser
Species Human (GRCh38)
Location 3:106674736-106674758
Sequence TGCATTGGGTGTACAACAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959464980_959464984 10 Left 959464980 3:106674703-106674725 CCAATCAGACTGATTGCAGGCCA 0: 19
1: 57
2: 114
3: 152
4: 270
Right 959464984 3:106674736-106674758 TGCATTGGGTGTACAACAAGTGG No data
959464983_959464984 -10 Left 959464983 3:106674723-106674745 CCATTACTTCATTTGCATTGGGT No data
Right 959464984 3:106674736-106674758 TGCATTGGGTGTACAACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959464984 Original CRISPR TGCATTGGGTGTACAACAAG TGG Intergenic
No off target data available for this crispr