ID: 959466662

View in Genome Browser
Species Human (GRCh38)
Location 3:106695825-106695847
Sequence CCTCATAATCTGAAGCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959466657_959466662 22 Left 959466657 3:106695780-106695802 CCTCATCTCCACTGCTGTTCTAT No data
Right 959466662 3:106695825-106695847 CCTCATAATCTGAAGCTACAAGG No data
959466659_959466662 -8 Left 959466659 3:106695810-106695832 CCCTGTGCACATACGCCTCATAA No data
Right 959466662 3:106695825-106695847 CCTCATAATCTGAAGCTACAAGG No data
959466658_959466662 14 Left 959466658 3:106695788-106695810 CCACTGCTGTTCTATTTCACTTC No data
Right 959466662 3:106695825-106695847 CCTCATAATCTGAAGCTACAAGG No data
959466660_959466662 -9 Left 959466660 3:106695811-106695833 CCTGTGCACATACGCCTCATAAT No data
Right 959466662 3:106695825-106695847 CCTCATAATCTGAAGCTACAAGG No data
959466656_959466662 23 Left 959466656 3:106695779-106695801 CCCTCATCTCCACTGCTGTTCTA No data
Right 959466662 3:106695825-106695847 CCTCATAATCTGAAGCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959466662 Original CRISPR CCTCATAATCTGAAGCTACA AGG Intergenic
No off target data available for this crispr