ID: 959469274

View in Genome Browser
Species Human (GRCh38)
Location 3:106729600-106729622
Sequence TTTTCTTTGAATATTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959469274_959469277 -5 Left 959469274 3:106729600-106729622 CCTTCCTCAATATTCAAAGAAAA No data
Right 959469277 3:106729618-106729640 GAAAAGCTGGAAGCATAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959469274 Original CRISPR TTTTCTTTGAATATTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr