ID: 959470092

View in Genome Browser
Species Human (GRCh38)
Location 3:106739328-106739350
Sequence GCTTAGCTGTTAGCTGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959470092_959470094 18 Left 959470092 3:106739328-106739350 CCTGAAGCAGCTAACAGCTAAGC No data
Right 959470094 3:106739369-106739391 CATGCAATGCTGCACAATGAAGG No data
959470092_959470095 23 Left 959470092 3:106739328-106739350 CCTGAAGCAGCTAACAGCTAAGC No data
Right 959470095 3:106739374-106739396 AATGCTGCACAATGAAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959470092 Original CRISPR GCTTAGCTGTTAGCTGCTTC AGG (reversed) Intergenic
No off target data available for this crispr