ID: 959470095

View in Genome Browser
Species Human (GRCh38)
Location 3:106739374-106739396
Sequence AATGCTGCACAATGAAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959470091_959470095 27 Left 959470091 3:106739324-106739346 CCTGCCTGAAGCAGCTAACAGCT No data
Right 959470095 3:106739374-106739396 AATGCTGCACAATGAAGGCCAGG No data
959470090_959470095 28 Left 959470090 3:106739323-106739345 CCCTGCCTGAAGCAGCTAACAGC No data
Right 959470095 3:106739374-106739396 AATGCTGCACAATGAAGGCCAGG No data
959470092_959470095 23 Left 959470092 3:106739328-106739350 CCTGAAGCAGCTAACAGCTAAGC No data
Right 959470095 3:106739374-106739396 AATGCTGCACAATGAAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959470095 Original CRISPR AATGCTGCACAATGAAGGCC AGG Intergenic
No off target data available for this crispr