ID: 959472216

View in Genome Browser
Species Human (GRCh38)
Location 3:106766000-106766022
Sequence GCAAATAAGGAGAAAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959472213_959472216 -6 Left 959472213 3:106765983-106766005 CCTTGAGGAAAAACAGAGCAAAT No data
Right 959472216 3:106766000-106766022 GCAAATAAGGAGAAAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959472216 Original CRISPR GCAAATAAGGAGAAAGAGGC AGG Intergenic
No off target data available for this crispr