ID: 959476243 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:106815487-106815509 |
| Sequence | CAGGGGACTCAGCATCTGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 959476243_959476249 | 27 | Left | 959476243 | 3:106815487-106815509 | CCCTCCAGATGCTGAGTCCCCTG | No data | ||
| Right | 959476249 | 3:106815537-106815559 | TATTTTTTTCATAGAAGCTTAGG | No data | ||||
| 959476243_959476250 | 28 | Left | 959476243 | 3:106815487-106815509 | CCCTCCAGATGCTGAGTCCCCTG | No data | ||
| Right | 959476250 | 3:106815538-106815560 | ATTTTTTTCATAGAAGCTTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 959476243 | Original CRISPR | CAGGGGACTCAGCATCTGGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||