ID: 959476244

View in Genome Browser
Species Human (GRCh38)
Location 3:106815488-106815510
Sequence ACAGGGGACTCAGCATCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959476244_959476249 26 Left 959476244 3:106815488-106815510 CCTCCAGATGCTGAGTCCCCTGT No data
Right 959476249 3:106815537-106815559 TATTTTTTTCATAGAAGCTTAGG No data
959476244_959476250 27 Left 959476244 3:106815488-106815510 CCTCCAGATGCTGAGTCCCCTGT No data
Right 959476250 3:106815538-106815560 ATTTTTTTCATAGAAGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959476244 Original CRISPR ACAGGGGACTCAGCATCTGG AGG (reversed) Intergenic
No off target data available for this crispr