ID: 959476246

View in Genome Browser
Species Human (GRCh38)
Location 3:106815504-106815526
Sequence TTGAAGAATTTATCTAACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959476246_959476250 11 Left 959476246 3:106815504-106815526 CCCCTGTTAGATAAATTCTTCAA No data
Right 959476250 3:106815538-106815560 ATTTTTTTCATAGAAGCTTAGGG No data
959476246_959476249 10 Left 959476246 3:106815504-106815526 CCCCTGTTAGATAAATTCTTCAA No data
Right 959476249 3:106815537-106815559 TATTTTTTTCATAGAAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959476246 Original CRISPR TTGAAGAATTTATCTAACAG GGG (reversed) Intergenic
No off target data available for this crispr