ID: 959476248

View in Genome Browser
Species Human (GRCh38)
Location 3:106815506-106815528
Sequence CTTTGAAGAATTTATCTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959476248_959476250 9 Left 959476248 3:106815506-106815528 CCTGTTAGATAAATTCTTCAAAG No data
Right 959476250 3:106815538-106815560 ATTTTTTTCATAGAAGCTTAGGG No data
959476248_959476249 8 Left 959476248 3:106815506-106815528 CCTGTTAGATAAATTCTTCAAAG No data
Right 959476249 3:106815537-106815559 TATTTTTTTCATAGAAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959476248 Original CRISPR CTTTGAAGAATTTATCTAAC AGG (reversed) Intergenic
No off target data available for this crispr