ID: 959476249

View in Genome Browser
Species Human (GRCh38)
Location 3:106815537-106815559
Sequence TATTTTTTTCATAGAAGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959476245_959476249 23 Left 959476245 3:106815491-106815513 CCAGATGCTGAGTCCCCTGTTAG No data
Right 959476249 3:106815537-106815559 TATTTTTTTCATAGAAGCTTAGG No data
959476243_959476249 27 Left 959476243 3:106815487-106815509 CCCTCCAGATGCTGAGTCCCCTG No data
Right 959476249 3:106815537-106815559 TATTTTTTTCATAGAAGCTTAGG No data
959476247_959476249 9 Left 959476247 3:106815505-106815527 CCCTGTTAGATAAATTCTTCAAA No data
Right 959476249 3:106815537-106815559 TATTTTTTTCATAGAAGCTTAGG No data
959476246_959476249 10 Left 959476246 3:106815504-106815526 CCCCTGTTAGATAAATTCTTCAA No data
Right 959476249 3:106815537-106815559 TATTTTTTTCATAGAAGCTTAGG No data
959476248_959476249 8 Left 959476248 3:106815506-106815528 CCTGTTAGATAAATTCTTCAAAG No data
Right 959476249 3:106815537-106815559 TATTTTTTTCATAGAAGCTTAGG No data
959476244_959476249 26 Left 959476244 3:106815488-106815510 CCTCCAGATGCTGAGTCCCCTGT No data
Right 959476249 3:106815537-106815559 TATTTTTTTCATAGAAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959476249 Original CRISPR TATTTTTTTCATAGAAGCTT AGG Intergenic
No off target data available for this crispr