ID: 959476250

View in Genome Browser
Species Human (GRCh38)
Location 3:106815538-106815560
Sequence ATTTTTTTCATAGAAGCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959476247_959476250 10 Left 959476247 3:106815505-106815527 CCCTGTTAGATAAATTCTTCAAA No data
Right 959476250 3:106815538-106815560 ATTTTTTTCATAGAAGCTTAGGG No data
959476245_959476250 24 Left 959476245 3:106815491-106815513 CCAGATGCTGAGTCCCCTGTTAG No data
Right 959476250 3:106815538-106815560 ATTTTTTTCATAGAAGCTTAGGG No data
959476246_959476250 11 Left 959476246 3:106815504-106815526 CCCCTGTTAGATAAATTCTTCAA No data
Right 959476250 3:106815538-106815560 ATTTTTTTCATAGAAGCTTAGGG No data
959476248_959476250 9 Left 959476248 3:106815506-106815528 CCTGTTAGATAAATTCTTCAAAG No data
Right 959476250 3:106815538-106815560 ATTTTTTTCATAGAAGCTTAGGG No data
959476243_959476250 28 Left 959476243 3:106815487-106815509 CCCTCCAGATGCTGAGTCCCCTG No data
Right 959476250 3:106815538-106815560 ATTTTTTTCATAGAAGCTTAGGG No data
959476244_959476250 27 Left 959476244 3:106815488-106815510 CCTCCAGATGCTGAGTCCCCTGT No data
Right 959476250 3:106815538-106815560 ATTTTTTTCATAGAAGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959476250 Original CRISPR ATTTTTTTCATAGAAGCTTA GGG Intergenic
No off target data available for this crispr