ID: 959477281

View in Genome Browser
Species Human (GRCh38)
Location 3:106826374-106826396
Sequence GTGCCTGTCTTGAAAAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959477281_959477289 27 Left 959477281 3:106826374-106826396 CCAGAGCTTTTCAAGACAGGCAC No data
Right 959477289 3:106826424-106826446 GACAGGCCTTAGGTAGCTATTGG No data
959477281_959477284 -8 Left 959477281 3:106826374-106826396 CCAGAGCTTTTCAAGACAGGCAC No data
Right 959477284 3:106826389-106826411 ACAGGCACTCAAAAGAGGGCTGG No data
959477281_959477285 10 Left 959477281 3:106826374-106826396 CCAGAGCTTTTCAAGACAGGCAC No data
Right 959477285 3:106826407-106826429 GCTGGATTTGTCCCAGAGACAGG No data
959477281_959477286 17 Left 959477281 3:106826374-106826396 CCAGAGCTTTTCAAGACAGGCAC No data
Right 959477286 3:106826414-106826436 TTGTCCCAGAGACAGGCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959477281 Original CRISPR GTGCCTGTCTTGAAAAGCTC TGG (reversed) Intergenic
No off target data available for this crispr