ID: 959478425

View in Genome Browser
Species Human (GRCh38)
Location 3:106840109-106840131
Sequence AGATAGAACAGAATGGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959478425_959478427 3 Left 959478425 3:106840109-106840131 CCACAAGCCATTCTGTTCTATCT No data
Right 959478427 3:106840135-106840157 GCCATGCTCAGCTGCCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959478425 Original CRISPR AGATAGAACAGAATGGCTTG TGG (reversed) Intergenic
No off target data available for this crispr