ID: 959482839

View in Genome Browser
Species Human (GRCh38)
Location 3:106894488-106894510
Sequence TAGTATGTACAGAAAGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959482836_959482839 -5 Left 959482836 3:106894470-106894492 CCCTCATTGTGTGGTGATTAGTA No data
Right 959482839 3:106894488-106894510 TAGTATGTACAGAAAGTAGAGGG No data
959482837_959482839 -6 Left 959482837 3:106894471-106894493 CCTCATTGTGTGGTGATTAGTAT No data
Right 959482839 3:106894488-106894510 TAGTATGTACAGAAAGTAGAGGG No data
959482835_959482839 -4 Left 959482835 3:106894469-106894491 CCCCTCATTGTGTGGTGATTAGT No data
Right 959482839 3:106894488-106894510 TAGTATGTACAGAAAGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959482839 Original CRISPR TAGTATGTACAGAAAGTAGA GGG Intergenic
No off target data available for this crispr