ID: 959483901

View in Genome Browser
Species Human (GRCh38)
Location 3:106906415-106906437
Sequence CGTCTAGAAGTGCAGGTATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959483901_959483905 15 Left 959483901 3:106906415-106906437 CCCTATACCTGCACTTCTAGACG No data
Right 959483905 3:106906453-106906475 GCATATTGACTTCGTAGCACTGG No data
959483901_959483906 20 Left 959483901 3:106906415-106906437 CCCTATACCTGCACTTCTAGACG No data
Right 959483906 3:106906458-106906480 TTGACTTCGTAGCACTGGACAGG No data
959483901_959483907 21 Left 959483901 3:106906415-106906437 CCCTATACCTGCACTTCTAGACG No data
Right 959483907 3:106906459-106906481 TGACTTCGTAGCACTGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959483901 Original CRISPR CGTCTAGAAGTGCAGGTATA GGG (reversed) Intergenic
No off target data available for this crispr