ID: 959496165

View in Genome Browser
Species Human (GRCh38)
Location 3:107054678-107054700
Sequence CTCTAGTTAGAAAACTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959496165_959496169 3 Left 959496165 3:107054678-107054700 CCAGCCAAGTTTTCTAACTAGAG No data
Right 959496169 3:107054704-107054726 TCTTCTCTGCTAAAATGTTGAGG No data
959496165_959496170 4 Left 959496165 3:107054678-107054700 CCAGCCAAGTTTTCTAACTAGAG No data
Right 959496170 3:107054705-107054727 CTTCTCTGCTAAAATGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959496165 Original CRISPR CTCTAGTTAGAAAACTTGGC TGG (reversed) Intergenic
No off target data available for this crispr