ID: 959496555

View in Genome Browser
Species Human (GRCh38)
Location 3:107058676-107058698
Sequence CAGTGTTACCATTTGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959496555_959496559 1 Left 959496555 3:107058676-107058698 CCAGCCACCAAATGGTAACACTG No data
Right 959496559 3:107058700-107058722 CATCTCCGATGATGGTAGCAAGG No data
959496555_959496561 15 Left 959496555 3:107058676-107058698 CCAGCCACCAAATGGTAACACTG No data
Right 959496561 3:107058714-107058736 GTAGCAAGGAGTGATACCAAAGG No data
959496555_959496558 -7 Left 959496555 3:107058676-107058698 CCAGCCACCAAATGGTAACACTG No data
Right 959496558 3:107058692-107058714 AACACTGACATCTCCGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959496555 Original CRISPR CAGTGTTACCATTTGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr