ID: 959496557

View in Genome Browser
Species Human (GRCh38)
Location 3:107058683-107058705
Sequence GAGATGTCAGTGTTACCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959496557_959496561 8 Left 959496557 3:107058683-107058705 CCAAATGGTAACACTGACATCTC No data
Right 959496561 3:107058714-107058736 GTAGCAAGGAGTGATACCAAAGG No data
959496557_959496559 -6 Left 959496557 3:107058683-107058705 CCAAATGGTAACACTGACATCTC No data
Right 959496559 3:107058700-107058722 CATCTCCGATGATGGTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959496557 Original CRISPR GAGATGTCAGTGTTACCATT TGG (reversed) Intergenic
No off target data available for this crispr