ID: 959496558

View in Genome Browser
Species Human (GRCh38)
Location 3:107058692-107058714
Sequence AACACTGACATCTCCGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959496553_959496558 15 Left 959496553 3:107058654-107058676 CCTGCAGCAGAGCACTTTGCAGC No data
Right 959496558 3:107058692-107058714 AACACTGACATCTCCGATGATGG No data
959496555_959496558 -7 Left 959496555 3:107058676-107058698 CCAGCCACCAAATGGTAACACTG No data
Right 959496558 3:107058692-107058714 AACACTGACATCTCCGATGATGG No data
959496552_959496558 16 Left 959496552 3:107058653-107058675 CCCTGCAGCAGAGCACTTTGCAG No data
Right 959496558 3:107058692-107058714 AACACTGACATCTCCGATGATGG No data
959496551_959496558 19 Left 959496551 3:107058650-107058672 CCTCCCTGCAGCAGAGCACTTTG No data
Right 959496558 3:107058692-107058714 AACACTGACATCTCCGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959496558 Original CRISPR AACACTGACATCTCCGATGA TGG Intergenic
No off target data available for this crispr