ID: 959496559

View in Genome Browser
Species Human (GRCh38)
Location 3:107058700-107058722
Sequence CATCTCCGATGATGGTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959496553_959496559 23 Left 959496553 3:107058654-107058676 CCTGCAGCAGAGCACTTTGCAGC No data
Right 959496559 3:107058700-107058722 CATCTCCGATGATGGTAGCAAGG No data
959496551_959496559 27 Left 959496551 3:107058650-107058672 CCTCCCTGCAGCAGAGCACTTTG No data
Right 959496559 3:107058700-107058722 CATCTCCGATGATGGTAGCAAGG No data
959496555_959496559 1 Left 959496555 3:107058676-107058698 CCAGCCACCAAATGGTAACACTG No data
Right 959496559 3:107058700-107058722 CATCTCCGATGATGGTAGCAAGG No data
959496556_959496559 -3 Left 959496556 3:107058680-107058702 CCACCAAATGGTAACACTGACAT No data
Right 959496559 3:107058700-107058722 CATCTCCGATGATGGTAGCAAGG No data
959496552_959496559 24 Left 959496552 3:107058653-107058675 CCCTGCAGCAGAGCACTTTGCAG No data
Right 959496559 3:107058700-107058722 CATCTCCGATGATGGTAGCAAGG No data
959496557_959496559 -6 Left 959496557 3:107058683-107058705 CCAAATGGTAACACTGACATCTC No data
Right 959496559 3:107058700-107058722 CATCTCCGATGATGGTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959496559 Original CRISPR CATCTCCGATGATGGTAGCA AGG Intergenic
No off target data available for this crispr