ID: 959496561

View in Genome Browser
Species Human (GRCh38)
Location 3:107058714-107058736
Sequence GTAGCAAGGAGTGATACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959496556_959496561 11 Left 959496556 3:107058680-107058702 CCACCAAATGGTAACACTGACAT No data
Right 959496561 3:107058714-107058736 GTAGCAAGGAGTGATACCAAAGG No data
959496557_959496561 8 Left 959496557 3:107058683-107058705 CCAAATGGTAACACTGACATCTC No data
Right 959496561 3:107058714-107058736 GTAGCAAGGAGTGATACCAAAGG No data
959496555_959496561 15 Left 959496555 3:107058676-107058698 CCAGCCACCAAATGGTAACACTG No data
Right 959496561 3:107058714-107058736 GTAGCAAGGAGTGATACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959496561 Original CRISPR GTAGCAAGGAGTGATACCAA AGG Intergenic
No off target data available for this crispr