ID: 959496870

View in Genome Browser
Species Human (GRCh38)
Location 3:107061771-107061793
Sequence TTGTATGTGCACATGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959496870_959496874 8 Left 959496870 3:107061771-107061793 CCTTCCATCATGTGCACATACAA No data
Right 959496874 3:107061802-107061824 GCAGTCTAGACCCCGGAAGAGGG No data
959496870_959496873 7 Left 959496870 3:107061771-107061793 CCTTCCATCATGTGCACATACAA No data
Right 959496873 3:107061801-107061823 AGCAGTCTAGACCCCGGAAGAGG No data
959496870_959496872 1 Left 959496870 3:107061771-107061793 CCTTCCATCATGTGCACATACAA No data
Right 959496872 3:107061795-107061817 GAAGTCAGCAGTCTAGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959496870 Original CRISPR TTGTATGTGCACATGATGGA AGG (reversed) Intergenic
No off target data available for this crispr