ID: 959497128

View in Genome Browser
Species Human (GRCh38)
Location 3:107064645-107064667
Sequence CTAGTGGTGCACGGTGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959497122_959497128 3 Left 959497122 3:107064619-107064641 CCCAAAGACCCGAGTAACAGTGA No data
Right 959497128 3:107064645-107064667 CTAGTGGTGCACGGTGATATAGG No data
959497125_959497128 -6 Left 959497125 3:107064628-107064650 CCGAGTAACAGTGACATCTAGTG No data
Right 959497128 3:107064645-107064667 CTAGTGGTGCACGGTGATATAGG No data
959497123_959497128 2 Left 959497123 3:107064620-107064642 CCAAAGACCCGAGTAACAGTGAC No data
Right 959497128 3:107064645-107064667 CTAGTGGTGCACGGTGATATAGG No data
959497124_959497128 -5 Left 959497124 3:107064627-107064649 CCCGAGTAACAGTGACATCTAGT No data
Right 959497128 3:107064645-107064667 CTAGTGGTGCACGGTGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959497128 Original CRISPR CTAGTGGTGCACGGTGATAT AGG Intergenic
No off target data available for this crispr