ID: 959498928

View in Genome Browser
Species Human (GRCh38)
Location 3:107082933-107082955
Sequence GTGGTGAACCTGACAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959498924_959498928 14 Left 959498924 3:107082896-107082918 CCTCAGTATCTGGCACTGTGCTG No data
Right 959498928 3:107082933-107082955 GTGGTGAACCTGACAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959498928 Original CRISPR GTGGTGAACCTGACAGAGCC TGG Intergenic
No off target data available for this crispr