ID: 959499867

View in Genome Browser
Species Human (GRCh38)
Location 3:107093643-107093665
Sequence ACTGGCTGCCTGGCTAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959499867_959499870 -9 Left 959499867 3:107093643-107093665 CCACTTTTAGCCAGGCAGCCAGT No data
Right 959499870 3:107093657-107093679 GCAGCCAGTAGGAATAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959499867 Original CRISPR ACTGGCTGCCTGGCTAAAAG TGG (reversed) Intergenic
No off target data available for this crispr