ID: 959502415

View in Genome Browser
Species Human (GRCh38)
Location 3:107121553-107121575
Sequence GGATGCAACAAATCTCATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959502411_959502415 8 Left 959502411 3:107121522-107121544 CCCTCTCTTTAGACATTTTATGC No data
Right 959502415 3:107121553-107121575 GGATGCAACAAATCTCATTTGGG No data
959502410_959502415 9 Left 959502410 3:107121521-107121543 CCCCTCTCTTTAGACATTTTATG No data
Right 959502415 3:107121553-107121575 GGATGCAACAAATCTCATTTGGG No data
959502412_959502415 7 Left 959502412 3:107121523-107121545 CCTCTCTTTAGACATTTTATGCA No data
Right 959502415 3:107121553-107121575 GGATGCAACAAATCTCATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959502415 Original CRISPR GGATGCAACAAATCTCATTT GGG Intergenic
No off target data available for this crispr