ID: 959519842

View in Genome Browser
Species Human (GRCh38)
Location 3:107313022-107313044
Sequence TTGCAAAAACTTGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959519842_959519845 -10 Left 959519842 3:107313022-107313044 CCTTCCTCCTCAAGTTTTTGCAA No data
Right 959519845 3:107313035-107313057 GTTTTTGCAATAGTTTCAACAGG No data
959519842_959519848 20 Left 959519842 3:107313022-107313044 CCTTCCTCCTCAAGTTTTTGCAA No data
Right 959519848 3:107313065-107313087 CCAGCTCTTCTTTGTACATCTGG 0: 195
1: 729
2: 3336
3: 5026
4: 6440
959519842_959519846 -5 Left 959519842 3:107313022-107313044 CCTTCCTCCTCAAGTTTTTGCAA No data
Right 959519846 3:107313040-107313062 TGCAATAGTTTCAACAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959519842 Original CRISPR TTGCAAAAACTTGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr