ID: 959521280

View in Genome Browser
Species Human (GRCh38)
Location 3:107325764-107325786
Sequence TTTCCCTTCCCACCAAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959521276_959521280 23 Left 959521276 3:107325718-107325740 CCTGAGAATTGCTCTCGGCCGAT No data
Right 959521280 3:107325764-107325786 TTTCCCTTCCCACCAAACCCTGG No data
959521278_959521280 5 Left 959521278 3:107325736-107325758 CCGATGCTAGCACAGGAAGCTCT No data
Right 959521280 3:107325764-107325786 TTTCCCTTCCCACCAAACCCTGG No data
959521273_959521280 30 Left 959521273 3:107325711-107325733 CCCTTCTCCTGAGAATTGCTCTC No data
Right 959521280 3:107325764-107325786 TTTCCCTTCCCACCAAACCCTGG No data
959521274_959521280 29 Left 959521274 3:107325712-107325734 CCTTCTCCTGAGAATTGCTCTCG No data
Right 959521280 3:107325764-107325786 TTTCCCTTCCCACCAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959521280 Original CRISPR TTTCCCTTCCCACCAAACCC TGG Intergenic
No off target data available for this crispr