ID: 959523916

View in Genome Browser
Species Human (GRCh38)
Location 3:107354500-107354522
Sequence CGAAGGTTCTTGAACTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959523916_959523919 17 Left 959523916 3:107354500-107354522 CCAAGACAGTTCAAGAACCTTCG No data
Right 959523919 3:107354540-107354562 TATCATTCTTTAGATTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959523916 Original CRISPR CGAAGGTTCTTGAACTGTCT TGG (reversed) Intergenic
No off target data available for this crispr